Labshake search
Citations for New England Biolabs :
351 - 400 of 6572 citations for Mono 3 Carboxypropyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The first duplicate was deglycosylated by PNGase F (NEB, 1:100) overnight at 37°C in 50 mM ABC prepared in pure H2O18 ...
-
bioRxiv - Cancer Biology 2021Quote: ... washed with 100 μl of 1 × NEBuffer 2.1 (NEB; Cat#: B7202S), and resuspended in 50 μl of 1 × NEBuffer 2.1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The digestion buffer consisted of 1:100 proteinase K (NEB, P8107S), 50 mM pH 8 Tris-HCl (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2% DMSO and 1 U Phusion high fidelty polymerase (NEB) in 1x buffer provided by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl T7 Endonuclease I (1 U/ul, M0302S, NEB) was added and incubated at 37°C for 1 hr ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated K227Q (200U; NEB)] was added ...
-
bioRxiv - Genomics 2019Quote: ... and 1 µl of NEBuffer 2 (New England BioLabs #B7002S), then heating in a thermocycler at 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 100 ng of unlabeled crRNA was mixed with equal volume of 2 × RNA loading dye (New England Biolabs) and fractionated in the 12% denaturing polyacrylamide gel ...
-
bioRxiv - Genomics 2021Quote: ... phage particles were lysed at 56 °C for 2 h in 550 μL of lysis buffer (100 mM Tris-HCl at pH 8.0, 27.3 mM EDTA, 2% SDS, ~1.6 U Proteinase K [NEB #P8107]). After lysis ...
-
bioRxiv - Cell Biology 2023Quote: ... beads were equilibrated in 1x PMP buffer (50 mM HEPES, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, pH 7.5; New England Biolabs). Kinase reactions were performed with 1 μL commercial CK1δ (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: Fresh omentum and omental HGSOC tumor metastasis biopsy samples were cut into small pieces and dissociated in digestion solution (1 mg/mL collagenase/Dispase [Sigma cat. no. 10269638001], 1 unit/mL DNase I [NEB, cat ...
-
bioRxiv - Developmental Biology 2023Quote: ... mRNA was isolated from 2.5 ug of total RNA using NEBnext Poly (A) magnetic isolation module (E7490S, NEB). The library was prepared as per the user’s manual using the NEBNext Ultra II Directional RNA library Prep Kit for Illumina (E7760S ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proximity ligation was performed using 1 unit/ml RNA ligase 1 (NEB), 1x RNA ligase buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cells were resuspended in 1 mL of 1× NEBuffer 2.1 (NEB) and homogenized by grinding to a fine powder in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... treated with apyrase (25 mU mL−1, NEB) and incubated at room temperature for another one hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl BsmBI (10,000 units/ml, NEB, R0580), and water was added to 14 μl ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 μl 10mg/ml Proteinase K (Biolabs, #P8107S), 1 μl 10mg/ml RNase A (ThermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... with 1 mL of Nuclear Extraction Buffer (NEB) for 10 sec at 4 m/s ...
-
bioRxiv - Biophysics 2019Quote: ... 20 μl of 1 mg/ml streptavidin (NEB) was then flowed through and washed with 40 μl of the same buffer.
-
bioRxiv - Genomics 2022Quote: ... 1% (v/v) BSA (20 mg/ml, NEB)] + 5μL of hash oligo (10 uM ...
-
bioRxiv - Biochemistry 2022Quote: ... and 1 unit/ml thermolabile proteinase K (NEB) in TE and incubated at 23°C for 1 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 U/ml T4 PNK (New England Biolabs), and labeled for 15 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 units mL-1 lambda protein phosphatase (NEB), and 0.1 μg mL-1 protein phosphatase 2a (Cayman Chemical ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Genomics 2020Quote: ... and followed by incubation with 3 μl (1 U/μl) of USER enzyme (NEB) at 37°C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... and ligated at a 3:1 amplicon:plasmid ratio with t4 DNA ligase (NEB, US) overnight at 16°C ...
-
bioRxiv - Genetics 2020Quote: ... remaining ssDNA oligonucleotides were digested by the addition of 3 μL exonuclease 1 (NEB) to 20 μL extracted DNA ...
-
bioRxiv - Genomics 2019Quote: ... in 1× Buffer 3 (Bionano Genomics) or 120 U of Nb.BssSI (New England Biolabs) in 1× NEBuffer 3.1 ...