Labshake search
Citations for New England Biolabs :
101 - 150 of 225 citations for FMOC L MEORN MTR OH since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... 0.75 μl of second strand mix (0.5 μl of mRNA second strand synthesis buffer and 0.25 μL of mRNA second strand synthesis enzyme, New England Biolabs) were added to each well ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Microbiology 2024Quote: ... Both PCR reactions used 0.02U/L Q5 Hot Start high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, USA) with 200M dNTPs and 0.5M forward and reverse primers in 1M Q5 reaction buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ChIP-seq libraries were built using an NEBNext® Ultra™ II DNA Library Prep Kit (NEB #E7645S/L) with immunoprecipitated or input DNA ...
-
bioRxiv - Microbiology 2024Quote: ... The INKV L fragment and the pINKV-L_linker backbone were digested with Aat II and Bsr GI (New England Biolabs), purified ...
-
bioRxiv - Molecular Biology 2021Quote: The singly nicked pCG09 plasmid was prepared by incubating CsCl purified negatively supercoiled pCG09 (60 μ l of 1X NEB Smart Cut buffer with the nicking endonuclease Nb.BbVCI (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... The NEBNext Ultra Directional RNA Library Prep Kit for Illumina was used to process the samples according to the protocol NEB #E7420S/L (New England Biolabs) to fragments of 300-500 bps ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μL RNA was mixed with 2 μL of 100 μM PvG748-SBS12-RT random hexamer primer (IDT) and 1 μL of 10 mM dNTP mix (NEB). The sample was incubated for 3 min at 65 °C and transferred to ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of the cDNA was used as template for the RT-PCR reaction with OneTaq DNA Polymerase (New England Biolabs). PCRs were run at the following conditions ...
-
bioRxiv - Genetics 2021Quote: Amplified DNA was digested at 37 L for 2 h with the restriction enzyme StyI-HF (NEB, Ipswich, MA, USA) and products were run on a 0.8 % agarose gel stained with Invitrogen™ SYBR™ Safe DNA Gel Stain (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Cancer Biology 2020Quote: ... We performed eight 100 µl PCR reactions per sample (4 µg DNA per reaction) using Q5 High-Fidelity 2x Master Mix (New England Biolabs)28 to maximize library sequencing quality ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μl of the diluted cDNA was used in 10 μl reaction mixture of Q5 Hot START DNA Polymerase kit (NEB) (2 μl of 5X buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the supernatant as template DNA was mixed with 10 μl 2x Universal qPCR Master Mix (New England BioLabs) and 1 μl of each oligonucleotide (Table S5 ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 µl of 2 U/µl Phusion polymerase and 160 µl of 40 U/µl Taq ligase (all enzymes from NEB). ddH2O was then added to a final volume of 1.2 ml.
-
bioRxiv - Biochemistry 2022Quote: ... 2 µL of the Klenow reactions were retrieved and added to 8 µL of 2x RNA Loading Dye (New England Biolabs). The mixtures were then analyzed by electrophoresis through a urea-15% polyacrylamide gel (Novex TBE-Urea gel 15% ...
-
bioRxiv - Physiology 2022Quote: ... 1 L of diluted extracts were incubated with 9 ml of packed amylose resin (catalog no. E8021S, New England Biolabs) and incubated at 4°C for 2h with gentle rotation ...
-
bioRxiv - Developmental Biology 2022Quote: Full-length cDNAs for wnt11b.L were amplified from wildtype or wnt11b-/- mutant oocyte total RNA using a high-fidelity polymerase (Q5, New England Biolabs). PCR products were cloned into pCR8/GW/TOPO (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... End-repair reaction was cleaned using 1.8X Agencourt AMPure XP beads and eluted in 15 µl of EB that was used for A-tailing reaction in 30 µl of NEBNext dA-Tailing reaction buffer (NEB) with 7.5 units of Klenow fragment exo- (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... End-repair reaction was cleaned using 2X Agencourt AMPure XP beads and eluted in 16.5 μl of EB that was used for A-tailing reaction in 20 μl of NEBNext dA-Tailing reaction buffer (NEB) with 7.5 U of Klenow fragment exo-(NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 0.2 μl 50x oligos (AarI recognition site) for Level 0 and Level 2 cloning or Eco31I/BsaI-HFv2 (ThermoFisher Scientific/NEB) for Level 1 cloning ...
-
bioRxiv - Biochemistry 2021Quote: The α-(1,2)-Galf-containing N-linked glycans were released from 1 mg Transglucosidase L “Amano” (Amano) by using PNGase F (New England Biolabs) under denaturing conditions ...
-
bioRxiv - Microbiology 2021Quote: ... The L-sNTurboID fragment was ligated back to the pCEZ-L backbone using the same restriction sites Pac1 and Hpa1 by NEB T4 ligase.
-
bioRxiv - Genomics 2020Quote: ... Each reaction is performed in 50 μl at 30°C overnight with 2 μl of circulated DNA with 2.5 μL of 10 μM (each) dNTPs (Catalog number: N0446S Vendor: New England Biolabs Inc), 2.5 μL Rolling cycle primer (10 μM) ...
-
bioRxiv - Microbiology 2021Quote: ... We then used a 1690 bp synthetic fragment (gBlock Gene Fragments from IDT) containing the digested L gene sequences and EGFP to be inserted by Gibson Assembly (NEBuilder HiFi DNA assembly, NEB). The gBlock contained mutations to replace nucleotides CT at rCDVRIVenus(6 ...
-
bioRxiv - Immunology 2021Quote: ... 10 μl of the eluted PCR product was used in a final indexing using NEBNext Multiplex Oligos for Illumina (E7710S, NEB) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... A 5 µL aliquot was taken in which primers and dNTPs were then inactivated using Exo-CIP Rapid PCR Cleanup Kit (NEB). From the resulting mixture ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... adding nuclease-free water to a final volume of 1 L) with 1:1000 (vol/vol) proteinase K (New England Biolabs) at 37°C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl of the plasmid DNA served as template for a 50 µl PCR (Q5 High-Fidelity 2X Master Mix, NEB) with primers PK412+PK421 (input library ...
-
bioRxiv - Genomics 2023Quote: ... The nuclei were pelleted by centrifuging at 500 g for 5 min at 4 °C and resuspended in 200 μl 1X NEBuffer 2.1 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg/ml BSA; NEB, B7202) in a 1.5 ml tube ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified lysate was applied to Glutathione Sepharose 4B affinity resin (1 ml bed volume per 2 l culture; New England Biolabs), and incubated with rotation for
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μl of indexed P7 (Cao et al., 2017) and 20 μl of NEBNext High-Fidelity master mix (New England Biolabs) were added to each well and PCR performed as follows ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then reverse crosslinked and lysed by adding 10μL of 10X Lysis-T (250mM EDTA, 2M NaCl, 10% Triton X-100) and 4μL of proteinase K (NEB, P8107S) and incubating at 55°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from 5-10 µl of the cell scrape and prepared for sequencing using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) with the following modifications ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µl of the Dpn I digested amplification product was transformed into 25 µl of NEB turbo competent E.coli (NEB, C2984). The desired mutation was initially confirmed by Sanger sequencing (Genomics Core Facility (UPF ...
-
bioRxiv - Microbiology 2024Quote: ... NEBNext Ultra II DNA Library Prep Kit for Illumina with NEBNext Multiplex oligos for Illumina (NEB cat # E7645S/L; E6440) following the instruction manual (V6.1_5/20 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L). The workflow was adapted to generate longer library fragments by reducing the fragmentation time (see manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 20 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 500 nM of each primer CCCTGTGGGTTTTACACTTAAAAAC and CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 10 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 1 µM of each primer ...
-
bioRxiv - Cancer Biology 2024Quote: ... perform 25-30 separate 100 µL reactions with 6-8 µg genomic DNA in each reaction using Q5 High-Fidelity DNA Polymerase (New England Biolabs) for around 18-20 cycles and then combine the resulting amplicons ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was diluted to 3ng/µl and 2µl per sample were added to a well containing 10µl Luna Universal Probe qPCR Master Mix (New England Biolabs, M3004), 1.6µl forward/reverse cyp1a primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L) as described for standard RNA-seq (42) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...