Labshake search
Citations for New England Biolabs :
1 - 50 of 225 citations for FMOC L MEORN MTR OH since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... A second adapter was then ligated to the 3’OH of the cDNAs (with NEB HC RNA Ligase in NEB ligation buffer plus 5% DMSO ...
-
bioRxiv - Biochemistry 2024Quote: ... In short 5’-phosphorylated and 3’-OH RNA was circularized with RNA ligase 1 (NEB) followed by denaturing PAGE purification as described above ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... the sRNA fraction (∼15- 35nt) was isolated by gel extraction and RNA species bearing 5’-OH were monophosphorylated by T4 polynucletide kinase (NEB). This was followed by treatment by a terminator exonuclease (Epicentre) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Systems Biology 2023Quote: ... 3’ ends of RNA were modified to have 3’ OH groups compatible for ligation using T4 Polynucleotide Kinase (NEB, #M0201L). Beads were incubated at 37°C for 10 minutes with shaking at 1200 rpm on a ThermoMixer ...
-
bioRxiv - Molecular Biology 2024Quote: ... A second adapter was then ligated to the 3’OH of the cDNAs (with NEB HC RNA Ligase in NEB ligation buffer plus 5% DMSO ...
-
bioRxiv - Bioengineering 2020Quote: ... Esp31 (NEB R0734S/L), and T7 DNA Ligase (NEB M0318S/L ...
-
bioRxiv - Bioengineering 2020Quote: ... Esp31 (NEB R0734S/L), and T7 DNA Ligase (M0318S/L) ...
-
bioRxiv - Bioengineering 2020Quote: ... Esp31 (NEB R0734S/L), and T7 DNA Ligase (M0318S/L ...
-
bioRxiv - Microbiology 2024Quote: ... Murine (NEB, #M0314S/L) and nuclease-free water at 37°C for 30 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... coli DNA ligase (NEB, #M0205 L), 5 μl of E ...
-
bioRxiv - Developmental Biology 2020Quote: ... coli DNA Polymerase (NEB, #M0209 L), 1 μl of dNTP (0 .2 mM) ...
-
bioRxiv - Bioengineering 2020Quote: ... BsaI-HF v2.0 (NEB R3733S/L), and T7 DNA Ligase with the same cycling conditions as the part vectors.
-
bioRxiv - Neuroscience 2023Quote: ... The sequencing libraries were generated by Genomescan using the NEBNext Low Input RNA Library Prep Kit from Illumina (New England Biolabs, cat#E6420S/L). In short ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15□l of 2.1 buffer (NEB), 30 units of SSP1 (NEB) ...
-
bioRxiv - Immunology 2024Quote: ... Exonuclease I treatment (NEB M0293 L) was used to remove excess primers ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 μ L of Protoscript II Reverse Transcriptase (200U/μ L, Catalog No. M0368, New England BioLabs Inc.), 2 μ L of 0.1M dithiothreitol (DTT) ...
-
bioRxiv - Immunology 2021Quote: ... coli DNA ligase (NEB, Cat. #M0205 L), 5 μl of E ...
-
bioRxiv - Immunology 2021Quote: ... coli DNA Polymerase (NEB, Cat. #M0209 L), 1 μl of 10mM dNTP (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... and T7 DNA Ligase (NEB M0318S/L) with the same cycling conditions as the part vectors.
-
bioRxiv - Molecular Biology 2024Quote: ... 1.5□l of 10m/ml BSA (NEB), 15□l of 2.1 buffer (NEB) ...
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... or Amylose Resin (NEB, 1 L, USA), that had been prewashed with respective lysis buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 mM (NEB, cat. no. N0447S/L)
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of Universal nuclease (Pierce; 125U/L of culture) and 10 μl of DNaseI (NEB; 20U/L of culture) were added and the mixture allowed to incubate for 10 min at RT ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 l of the DNA was used in a 50 l PCR reaction with the enzyme Q5 polymerase (New England Biolabs) and the primers Cytb-f AGTCCTAGTGTAATGGAAGCand Cytb-r ATCTTCAACGTGTTTAGCACC (annealing temperature 61.5°C) ...
-
bioRxiv - Microbiology 2021Quote: ... L: 100 bp DNA Ladder (New England Biolabs). 1 ...
-
bioRxiv - Bioengineering 2023Quote: T4 Polynucleotide Kinase (NEB cat. no. M0201S/L)
-
bioRxiv - Bioengineering 2023Quote: Bsu36I restriction enzyme (NEB cat. no. R0524S/L)
-
bioRxiv - Genetics 2023Quote: ... Index primers set 1 and 2 from the NEBNext Multiplex Oligos for Illumina kit (New England Biolabs, E7335S/L E7500S/L) were incorporated using Herculase II Fusion Polymerase Kit (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Bioengineering 2023Quote: BsaI-HFv2 restriction enzyme (NEB cat. no. R3733S/L)
-
bioRxiv - Genetics 2020Quote: ... 5 μl of Klenow exo- (NEB M0212S/L, 5U/μl) was added ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1.5 µ l of T4 Polynucleotide Kinase (NEB, M0201L). Following incubation ...
-
bioRxiv - Plant Biology 2022Quote: ... enzyme (MBP-DcATX1C) and S-adenosyl-L-methionine (SAM; NEB) were incubated for 0h ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-L-lactyllysine (pan-Kla, PTM BIOLABS, PTM1401, 1:1000), anti-H3K9la (PTM BIOLABS ...
-
bioRxiv - Bioengineering 2023Quote: SalI restriction enzyme (NEB cat. no. R0138S/T/L/M)
-
bioRxiv - Bioengineering 2023Quote: KpnI-HF restriction enzyme (NEB cat. no. R3142S/L/M)
-
bioRxiv - Bioengineering 2023Quote: T4 DNA Ligase (NEB cat. no. M0202S/T/L/M)
-
bioRxiv - Microbiology 2020Quote: ... or 2 μL of Shortcut RNase III (0.02 L/μL; NEB) were added and incubated for 45 seconds ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) and 1.5 µ l of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... or the LunaScript RT Super Mix Kit (NEB # E3010(S/L), Ipswich ...
-
bioRxiv - Molecular Biology 2023Quote: ... Synthesis was performed with a Large Fragment of Pol l (NEB) at 30°C for 1 h ...
-
bioRxiv - Bioengineering 2023Quote: PstI-HF restriction enzyme (NEB cat. no. R3140S/L/T/M)
-
bioRxiv - Bioengineering 2023Quote: BamHI-HF restriction enzyme (NEB cat. no. R3136S/L/T/M)
-
bioRxiv - Genetics 2020Quote: ... and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L), and incubated for 4 hours at room temperature with rotation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The NEBNext® Ultra II FS DNA module (cat# NEB #E7810S/L) and the NEBNext® Ultra II Ligation module (cat# NEB #E7595S/L ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and the NEBNext® Ultra II Ligation module (cat# NEB #E7595S/L) were used to process the samples ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-rabbit IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) or anti-mouse IgG (H+L ...