Labshake search
Citations for New England Biolabs :
101 - 150 of 2099 citations for 8 Cyclopropylamino 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biochemistry 2020Quote: ... then extended and inserted into pCS2+8 or pET28a linearized with EcoRI (NEB). All inserts were fully sequenced by Sanger sequencing at the Cornell Genomics Core Facility.
-
bioRxiv - Biochemistry 2019Quote: ... Peak fractions were pooled and passed over an 8 mL amylose column (NEB), washed with 5 CV of Amylose Wash Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Genomics 2020Quote: ... 15 mM HEPES pH 8) and 20 μl of DNase I (M0303S, NEB). The Nuclease Flushing mix was loaded into the flow cell and incubated for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were then successively treated with 8 U/mL DNase I (NEB; M0303S) for 5 min at 37°C and 4 U/mL RNase I for 3 min at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... 2 μM X4L4 or 8 U/μL T4 DNA ligase (New England BioLabs) and an increasing amount of PEG 8k (w/v ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli (NEB 5-alpha) for bacterial transformation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg BSA (NEB), 9 mM DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... RecBCD (NEB, 5 U), NcoI- HF (NEB ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC) with T4 RNA ligase I (NEB). The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Genomics 2022Quote: ... and followed by a 5′ decapping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S). The 5′ end was phosphorylated using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... and the m7G(5’)ppp(5’)G RNA Cap Structure Analog (#S1411, NEB) kits ...
-
bioRxiv - Microbiology 2022Quote: ... with the addition of an m7G(5⍰)ppp(5⍰])G RNA cap (NEB). Transcription was carried out at 42°C for 2 hours (h ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of nuclease-free water and 5 µL of GA mastermix (NEB) were added and incubated at 40°C for a minimum of 1.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 mM G(5’)ppp(5’)G RNA Cap Analogue (New England Biolabs), 4 μg DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of 5’ adaptor required (i) Removal of the 5’ cap using RNA 5’ pyrophosphohydrolase (RppH, New England Biolabs, Ipswich, MA, M0356S) (ii ...
-
bioRxiv - Neuroscience 2021Quote: ... 8 μg of DNA were treated with 30 U of RNase H (NEB, M0297) for 16 h at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... and 8 μL of 5U/μL DNA Polymerase I Large (Klenow) Fragment (NEB M0210). The reaction was the incubated at 37°C in a Thermomixer at 900 rpm for 45 minutes.
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL Bacillus stearothermophilus (Bst) DNA polymerase (8 U μl-1) (New England Biolabs), 2 μL DNA template ...
-
bioRxiv - Genomics 2021Quote: ➢ Distinct from currently used length 8 barcodes from common library kits (Illumina TruSeq, NEB)
-
bioRxiv - Molecular Biology 2023Quote: ... and 200 μM dNTPs and 8 units of Bst 2.0 warmstart DNA polymerase (NEB) were added and reaction was incubated at 65°C for 2 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μg bovine serum albumin (BSA) and 8 units Phi29 DNA polymerase enzyme (NEB). Amplification reactions were monitored for 5 hours at 30 °C in MicroAmp fast reaction tubes with cap (Applied Biosystems ...
-
bioRxiv - Genomics 2023Quote: ... and 8 μL of 5U/μL DNA Polymerase I Large (Klenow) Fragment (NEB #M0210). The reaction was the incubated at 37 °C in a Thermomixer at 900 rpm for 45 minutes.
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... in the presence of m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB). 5 μg DENV-Luc RNA was electroporated into 2×106 Vero cells ...
-
bioRxiv - Genetics 2022Quote: ... The m7G(5’)ppp(5’)G RNA Cap (New England BioLabs, catalog number S1404L) was used as Cap Analog with 4:1 of Cap Analog:GTP ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ ends were dephosphorylated using 5 U of Antarctic phosphatase (New England BioLabs/M0289S). A mix containing the RNA sample (~10 pmol) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Genomics 2024Quote: ... the 5’ end of RNAs were enzymatically modified with RNA 5’ Pyrophosphohydrolase (RppH; NEB) and hydroxyl repair was performed using T4 Polynucleotide Kinase (PNK ...