Labshake search
Citations for New England Biolabs :
1 - 50 of 2099 citations for 8 Cyclopropylamino 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 8 μl 5 U/μL Klenow Fragment (NEB, M0210S) and 2 μl T4 PNK (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... and then passed over an 5-8 mL amylose column (NEB). The bound protein was washed with ten CV of Amylose Wash Buffer (50 mM Tris pH 7.5 ...
-
bioRxiv - Genetics 2019Quote: ... and 5 U/µl DNA polymerase I Klenow (8 µl; New England Biolabs), and incubated for 90 min at 37°C with rotation ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: GBL phosphate (8) was incubated with 5 units of calf intestinal alkaline phosphatase (CIP, New England Biolabs) in 50 mM HEPES buffer (pH 8.0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA pellets were resuspended in 5 µL dephosphorylation reaction mix (7 mM Tris pH 8, 1x NEB T4 PNK buffer ...
-
bioRxiv - Genomics 2019Quote: The circularized DNA was split into 8 50 ul rolling circle amplification (RCA) reactions (5 ul 10x Phi29 buffer (NEB), 2.5 ul 10 mM dNTPs (NEB) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Chromatin was then digested by adding 12 μl of 10x NEBuffer3.1 and 8 μl of 5 U/μl DpnII (NEB, R0543) followed by a 2h incubation at 37ºC in a ThermoMixer with shaking (900 rpm ...
-
bioRxiv - Biophysics 2019Quote: ... 10 μl of 100 μM DNA oligos containing an amino group modification at their 5’ends were mixed with 8 μl of 20 mM BG-GLA-NHS (NEB) in 40 μl of 50 mM HEPES buffer containing 50% anhydrous DMSO ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs] ...
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 min and then samples were incubated with ligation buffer (8 μl of 5x ligation stock (New England Biolabs, USA), 1 μl ligase and 31 μl of ultrapure water on each coverslip ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... The end-repaired DNA was ligated with 5 μl Adapter Mix (ONT, SQK-LSK110) using 8 μl NEBNext Quick T4 DNA ligase (NEB, E6056) at 21°C for up to 1h ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 8 mM rNTPs (NEB #N0466S), 250 U T7 RNA Polymerase (NEB #M0251L ...
-
bioRxiv - Biophysics 2023Quote: ... 8 μl XhoI (NEB, R0146S) and 8 μl DpnI (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... 8 µl klenow polymerase (NEB M0210L) and 37.5 µl Biotin-14-dATP (Thermo 19524016 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 8 ul 5X HF buffer (NEB), 1 ul 25 uM library 1st round forward primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μl 50% PEG 8000 (NEB), 1.3 μl T4 RNA ligase (30 U/µl ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 units of RNAse inhibitor (NEB), and 10 µm of malachite-green dye was added to each reaction.
-
bioRxiv - Neuroscience 2023Quote: ... 8 U/mL Proteinase K (NEB)) and incubated overnight at RT ...
-
bioRxiv - Biophysics 2023Quote: ... and 8 μl DpnI (NEB, R0176S) in 400 μl final volume ...
-
bioRxiv - Genomics 2020Quote: ... 8 units of SbfI and 8 units of HF-MseI (New England Biolabs, Frankfurt am Main, Germany). Digestion was performed at 37°C for 2 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... 8 μL 5x first-strand buffer (NEB), 2 μL 10 mM dNTPs (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 8 μl DpnII (400 U, NEB, R0543M) was added to each and samples were incubated at 37°C overnight with rotation.
-
bioRxiv - Bioengineering 2019Quote: ... 8 U/µl Taq DNA ligase (NEB), 2 mM β-Nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 μl NEB RNase If (NEB M0243S) per OD260 of ~10 was added in 2ml of lysis buffer ...
-
bioRxiv - Biophysics 2020Quote: ... and loading dye (8 μL, B0363S, NEB) and loaded denatured (70 °C ...
-
bioRxiv - Physiology 2019Quote: ... and 8 μl of PNGase F (NEB) were added ...
-
bioRxiv - Immunology 2020Quote: ... or 8 μM bortezomib (BTZ; LC Biolabs). Mock treatment consisted of an equivalent volume of the matching solvent ...
-
bioRxiv - Molecular Biology 2022Quote: ... 8 U murine RNase inhibitor (NEB # M0314), 0-1 μM recombinant protein ...
-
bioRxiv - Biochemistry 2023Quote: ... 8 U murine RNase inhibitor (NEB # M0314L), and 0-3.4 μM recombinant protein ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 injected embryos and 8 control uninjected siblings were assayed by PCR amplification and T7 endonuclease (New England Biolabs, M0302S) digest for mutation analysis41 ...
-
bioRxiv - Genomics 2020Quote: ... 0.2% SDS) with 8 μL Proteinase K (NEB) at 65°C for 1 hour ...
-
bioRxiv - Genetics 2020Quote: ... 8 µL of T4 DNA ligase (NEB #M0202M), and water to 800 µL ...
-
bioRxiv - Cell Biology 2021Quote: ... and 8 μl of phosphatase reaction buffer (NEB). After incubation at 30°C for 30 minutes ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... 8 U/ml DNaseI (RNase-free, NEB, M0303L) were added to each sample ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µL of Phusion HF Buffer (NEB #B0518S), and 0.8 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Cell Biology 2023Quote: ... 8 U/ml proteinase K (New England Biolabs) diluted in digestion buffer (containing 50 mM Tris pH 8.0 (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... along with 8 units of RNAse inhibitor (NEB), and 10 µm malachite green oxalate added to each reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... using 8 units of T4 RNA ligase 1 (NEB) and 8 nmol of ATP in a final volume of 8 μl for 1 h at 37°C ...