Labshake search
Citations for New England Biolabs :
251 - 300 of 2099 citations for 8 Cyclopropylamino 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL High GC Enhancer (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... 5 µl 10x CutSmart buffer (NEB), 1 µl PsiI enzyme (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... 5 uL 5X Phusion Buffer (NEB), 10 uL 1M Trehalose (Life Sciences Advanced Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL 5′deadenylase (NEB #M0331S), 1 µL of RiboLock (ThermoFisher #EO0381 ...
-
bioRxiv - Immunology 2023Quote: ... 5 µL of GC Enhancer (NEB), 5 µL of 5X buffer ...
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Genomics 2023Quote: ... or 5 U MboI (NEB R0147S) in 15 μl rCS buffer for 1 h at 37°C and analysed in a 1.2% agarose gel containing ethidium bromide ...
-
bioRxiv - Immunology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart 10x (NEB), 2 μl of BSA (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units of antarctic phosphatase (NEB), and 1 mM manganese chloride ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of Antarctic Phosphatase (NEB) and 10 mU/µL of phosphodiesterase I (PDEI ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: PCR was performed on toe clippings that were incubated overnight at 55° C in tail lysis buffer (10mM Tris pH 8, 0.4M NaCl, 2mM EDTA, 0.1% SDS, 3.6U/mL Proteinase K (NEB)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 8 μL of the de-phosphorylated DNA was incubated with 2 μL T4 Polynucleotide Kinase (NEB M0203S), 3 μL γ32P-dATP (Perkin Elmer) ...
-
bioRxiv - Microbiology 2021Quote: ... purified RNA (8 μl) was converted into cDNA using a LunaScript RT SuperMix Kit (New England Biolabs) and used as a template in two separate amplification reactions generating odd- and even-numbered tiled amplicons ...
-
bioRxiv - Molecular Biology 2020Quote: ... an additional 32 µL of MyK buffer and 8 µL of Proteinase K (NEB, #P8107S, Ispwich, MA) were added to each tube ...
-
bioRxiv - Molecular Biology 2021Quote: ... washed once with media and released for 8 hours with 24 mM dCTP (New England Biolabs # N0441S). 2 mM of thymidine or 0.1 mg/ml of Nocodazole (Millipore-Sigma # SML1665 ...
-
bioRxiv - Molecular Biology 2021Quote: RNA used for RT-PCR was treated with 8 U of DNase I (RNase-free, NEB, M0303) for 15 min at 37 °C in a 50 μl reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μg of the purified DNA was digested with 8 units of Endo V (New England Biolabs) in a 200 μL reaction at 37 °C for 2 h ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were then loaded onto an 8% polyacrylamide gel alongside a 50 bp ladder (New England Biolabs) and resolved at 100 V for 45 minutes in TBE buffer ...
-
bioRxiv - Genomics 2023Quote: ... Each reverse transcription reaction contained 8 μL template RNA and 2 μL LunaScript RT SuperMix (NEB #E3010). The reaction condition for reverse transcription was ...
-
bioRxiv - Genomics 2023Quote: ... The product was purified with 1.8× Ampure XP beads and eluted in 8 μL elution buffer (NEB). The DNA was denatured by addition of 2 μL 0.1 M freshly diluted NaOH and incubation at 50°C for 10min ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 PCR cycles for enrichment of adaptor-ligated DNA with unique dual index primer pairs from NEB. The libraries were sequenced on the NovaSeq 6000 system with NovogeneAIT Genomics ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting eluant was further treated with 1% SDS and 8 U/mL proteinase K (NEB, P8107S) at 42°C for 20 minutes then phenol chloroform extracted and ethanol precipitated.
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... with oligos 5’-GGTGGTTGCTCTTCCAACGCTGACGCTAAGGAGATTGTG-3’ and 5-GGTGGCATATGTTAGATGGTCATGCCGGAGG-3’ and cloned with SapI and NdeI into Tyb21 (NEB), giving pFW38 ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Genetics 2021Quote: ... 10μl Klenow (3’-5’ exo-) (M0202L, NEB), and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
bioRxiv - Genomics 2019Quote: ... 5 µL PNK (10 U/µL, NEB) was added ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Quick T4 Ligase (NEB) in 1X Quick Ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 U Antarctic phosphatase (New England BioLabs) and labeled internal standards were added ([15N2]-cadC 0.04301 pmol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 32mM S-Adenosyl methionine (NEB) (final concentration 0.8 mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... protein tyrosine phosphatase (PTP, 5 unit; NEB), or sodium orthovanadate (Na3VO4 ...