Labshake search
Citations for New England Biolabs :
1401 - 1450 of 6344 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... EcoRI-HF (5’ GAATTC 3’) (New England BioLabs Inc., Ipswich, MA). gDNA samples that showed poor banding patterns or could not be digested by the enzymes listed above were then digested with Taq⍺I (5’ TCGA 3’ ...
-
bioRxiv - Biophysics 2020Quote: ... mixed with 3 μL 4x LDS loading dye (New England Biolabs) and loaded onto 4-12% NuPAGE Bis-Tris gels (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... in NEB next Quick ligation buffer (3 μl, New England Biolabs) in the presence of 1 μl RNA CS (Oxford Nanopore Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Genetics 2022Quote: ... and a 3’ loxP site in a HiFi Assembly reaction (NEB) with pBS-ISceI to give pBSIce-gata2aKI (Supplementary File 1).To construct a foxc1a targeting vector ...
-
bioRxiv - Microbiology 2022Quote: ... followed by 3′ adaptor ligation using T4 ligase (New England Biolabs). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... All samples were mixed with 3 μl Proteinase K (NEB P8107S) and incubated for 1 hour at 50°C ...
-
bioRxiv - Microbiology 2022Quote: ... The 3’ adenine (A) overhangs were then added by Taq (NEB) PCR and cloned into the TOPO-TA plasmid (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... 3 mM CaCl2) and was subjected to mild MNase (NEB, M0247S) treatment (20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fragmented RNA was 3’-end repaired using T4 PNK (NEB) and ligated to RNA adapter (5’-/5rApp/AGATCGGAAGAGCGTCGTG/3SpC3/-3’ ...
-
bioRxiv - Genetics 2024Quote: ... and 3 units of Taq DNA Polymerase (New England Biolabs, Inc.) under the following reaction conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... digests were eluted in 1X NEBuffer #3 (B7003S, New England Biolabs) and undigested gDNA was eluted in TE ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and ligated species specific 3’ UTR with T4 DNA ligase (NEB). Each of the full length chimeric nos rescue fragments were cloned into pattB vectors using NotI (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 25 pmol of SSAs were folded in 1x NEBuffer 3 (NEB) by heating at 95°C for 5 min followed by slow cooling to 25°C ...
-
bioRxiv - Genomics 2023Quote: ... was digested for 3 hours with PvuII-HF (NEB cat #R3151S) or PstI (NEB cat #R0140T ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purified PCR products were 3′A-tailed using Taq polymerase (NEB) and cloned into TOPO TA-cloning vector (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... 3 μL of T4 RNA ligase buffer (NEB, cat. no: M0204S), 1 μL of 10 mM ATP (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3′-A overhang was added with Klenow fragment (NEB; M0212) and dATP ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 U Klenow Fragment (3’ -> 5’ exo-) (New England BioLabs) and H2O to 20 μL ...
-
bioRxiv - Systems Biology 2024Quote: ... and A-tailed using Klenow HC 3′ → 5′ exo (#M0212L; NEB).
-
bioRxiv - Microbiology 2024Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Cell Biology 2024Quote: H in the reaction buffer containing GlycoBuffer 3 (B1720S, NE BioLabs) for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: NEBNext 3’ SR adaptors for Illumina (New England Biolabs, cat# E7332) were ligated to the 3’ ends of total RNA from EVs and cellular samples isolated from an RN cell line using a truncated KQ T4 RNA ligase 2 (New England Biolabs ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (fhuA2 [lon] ompT gal (lambda DE3) [dcm] ΔhsdSlambda DE3 = lambda sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5) (New England Biolabs, C2527I) were used ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... coli (10-beta, NEB, C3020K) were thawed on ice and mixed with 6 µg of purified 3Cs-DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 U of HaeIII (NEB), and >0.1 pg of genomic template DNA ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli NEB 10-beta (NEB) was used for cloning ...
-
bioRxiv - Genomics 2021Quote: ... 10 μL buffer 3.1 (NEB) and ultrapure water to a final volume of 70 μL ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl DpnII (R0543M, NEB) (500 U per tube ...
-
bioRxiv - Bioengineering 2020Quote: ... 10 units BsaI (NEB #R3733), 10 units PNK (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units BsaI-HFv2 (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 10 μl MboI (NEB R0147S), 5 μl CviQI (NEB R0639S) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mm NTP mix (NEB), Ribolock (Thermo scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli cells (NEB 10-beta). The recombinant N-terminal His6-tagged TrxA protein encoded by slr0623 was expressed and purified as previously described previously for His-tagged proteins (Lapina et al ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 U BsaI-HFv2 (NEB) for assembly into levels 1 and 3 or 10 U BpiI (Thermo Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... 10 µg λ DNA (NEB) was added to a 50 µL reaction with 80 µM biotin-dCTP (Invitrogen) ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μl PNK enzymes (NEB) and 15 μl of 10mM ATP and incubated at 37°C for 10 mins on a Thermomixture (1400 rpm) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli 10-beta (NEB C3020) cells ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 10 U MseI (NEB, R0525S), 1x ddPCR supermix for probes and 50-300 ng of genomic DNA (gDNA) ...
-
bioRxiv - Biochemistry 2021Quote: ... E.coli (NEB® 10-beta) containing both a Cas effector and gRNA plasmid (Table S3 ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 U T5 exonuclease (NEB) were added ...
-
bioRxiv - Cell Biology 2020Quote: ... with 10 mM VRC (NEB) per coverslip for 10 minutes at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 0.23μl 10 mM dNTPs (NEB), 0.08 μl 10 U/μl E ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 ul rCutSmart Buffer (NEB). The mixes of retrons were organized according to their relative production to retron-Eco1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 μl RNase H (NEB), and 70 μl nuclease-free H2O to the cDNA mixture and incubation at 37 °C for 15 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 units PNK (NEB) in 50 μl PNK buffer 1X (30’ at 37°C ...