Labshake search
Citations for New England Biolabs :
1251 - 1300 of 6344 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... all final Illumina compatible ERα STARRseq and ERα-focused STARR-seq capture libraries were prepared by PCR amplification (7 cycles) with NEBNext universal and single indexing primers (NEB), and were sequenced on Illumina NovaSeq 6000 (150bp Paired-End).
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was performed for 7-11 cycles (depending on input DNA concentration) using NEBNext Mulitplex Oligos (New England Biolabs). Indexed sample concentration was quantified using the KAPA Library Quantification Complete Kit (Universal)(Roche) ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: Assessment of the integration status of the HPV-positive HNSCC cell lines was characterized for each cell line and digested with 7 µg of total genomic DNA at 37°C overnight (20 hours) with either EcoRV (New England BioLabs) or Bam HI ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Ligation was performed on a 7-fold dilution of HindIII-digested chromatin using 100 units of Quick T4 DNA ligase (New England Biolabs) at 16°C for 16 hours ...
-
bioRxiv - Microbiology 2024Quote: ... The colonies were screened for insert using Check1_ins_pSW_for and Check1_ins_pSW_rev primers from Supplementary Data 7 using Phusion polymerase (NEB, Phusion High Fidelity DNA Pol, M0530L) polymerase for inserts >5kb (PCR thermocycling conditions were as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... GDNA was isolated from 7 dpf efemp1+/+ or efemp12C-Cas9 zebrafish eyes using a Monarch Genomic DNA Purification Kit (T3010S; NEB) and quantified using a Nanodrop 1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2019Quote: ... DNA was digested by adding 10 µL NlaIII (10 U/µL, NEB) and incubated for 3½ h at 37 °C with shaking at 1200 rpm ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ligation reaction (10 μL) consisted of 10 units of BbsI (NEB), 600 units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnII (NEB), 1X DpnII buffer (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnI (NEB), 1X CutSmart (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... coli 10-Beta (NEB) and BL21(DE3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3’ deoxy-adenine overhangs were added using Klenow Fragment (NEB), the sample was purified with QIAquick column ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions contained 3 µL of BSA (New England Biosciences (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 μl AnP stock (5,000 units/ml, New England Biolabs) was added to 50 μM purified CST in Buffer A along with 0.5 mM ZnCl2 and 1mM MgCl2 ...
-
bioRxiv - Genomics 2021Quote: ... Adenylation was performed with 3’-5’ Klenow Fragment (NEB M0212L). Adaptors were ligated with NEB Quick Ligase for 10 minutes at 30°C before two rounds of cleanup with homemade beads ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Klenow fragment (3′ → 5′ exo−) (New England Biolabs). Hybridization was performed at 65°C overnight in the pre-hybridization solution containing 6x saline-sodium citrate buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... NEB Buffer 3 was replaced by T4 PNK buffer (NEB) in kinase assays in the presence or absence of Xrn1 (Figs 3a and 5d) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 15 units of Klenow Fragment (3’→5’ exo-, NEB). Following extension reactions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit) were added and incubated for 18 h at 16°C over-night ...
-
bioRxiv - Biochemistry 2022Quote: ... A-tailing (Klenow fragment (3’-5’ exo–, New England Biolabs), ligation to barcoded adapters (KAPA) ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.17 μL of random primers (3 mg/mL NEB) in a total volume of 5.25 μL ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’-CTTTTGACATCCGCTTCTGC-3’ followed by a T7 endonuclease assay (NEB) to detect indels ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by A-tailing (Klenow 3’-> 5’ exo-, NEB, M0212S). After A-tailing ...
-
bioRxiv - Bioengineering 2019Quote: ... and 3’-A-tailed with NEBNext dA-Tailing Module (NEB) following the recommendations of the manufacturer ...
-
bioRxiv - Genomics 2020Quote: ... 3 mM DTT 8 μl Large Klenow Fragment (NEB, #M0210L) and 2 μl T4 PNK (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... gDNA (3 μg) was digested by HpaII (New England Biolabs) at 37°C for 1 hr ...
-
bioRxiv - Biochemistry 2021Quote: ... and 40 U of β1-3 Galactosidase (New England Biolabs) for 16 h at 37°C.
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA (3 μg) was treated with DNase (New England Biolabs) and reverse transcribed using random primer mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼500 bp 5’ and 3’ flanking regions of Tb427.10.12290 (NEB) with primers SMD400/1 and SMD404/5 respectively using (Lister strain 427 ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µl Ultra II end prep enzyme mix (NEB), and incubated at 20 °C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA 3’ ends were dephosphorylated using T4 PNK (NEB, M0201). DNA ends were then blunted using T4 DNA polymerase (NEB ...
-
bioRxiv - Genomics 2024Quote: ... followed by 3′ adapter ligation using T4 RNA ligase (NEB). Biotinylated RNAs were enriched for a second time ...
-
bioRxiv - Genomics 2023Quote: ... and 7.5 U of Klenow fragment 3’→5’ exo-(NEB), except for input DNA that is degraded (e.g. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µL Ultra II End-prep enzyme mix (NEB, E76468). The mixture was incubated at 20 °C for 5 minutes and 65 °C for 5 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 μL of Klenow Fragment (3’ -> 5’ exo -, NEB M0212L), 5 μL 50% PEG 8000 ...
-
bioRxiv - Cell Biology 2023Quote: ... using Large Klenow fragment 3’-5’ exo- (New England Biolabs). Biotinylated 19x 601 array DNA ...
-
bioRxiv - Genomics 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (New England Biolabs) for 30 min at 37 °C and purified by using a QIAquick PCR Purification Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... A-tailing by Klenow Fragment (3’è5’ exo-; NEB M0212S), and TruSeq 6-bp index adaptor ligation by Quick ligase (NEB M2200S) ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL NEBNext Ultra II End Prep Enzyme Mix (NEB), and nuclease-free water (NFW) ...
-
bioRxiv - Genomics 2023Quote: ... 3 uL of 10x T4 ligase buffer (New England Biolabs), 75 ng destination vector ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL containing 0.01 U Bst 2.0 DNA polymerases (NEB), 0.5 U SplintR ligase (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (3 μL APOBEC reaction buffer (NEB), 0.3 μL APOBEC (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Genomics 2024Quote: ... The 3 library pools were purified by an ExoSAPII (NEB) reaction to remove single-stranded DNA and further by column purification (MiniElute Gel Extraction Kit ...