Labshake search
Citations for New England Biolabs :
1651 - 1700 of 6344 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... 5 µL PNK (10 U/µL, NEB) was added ...
-
bioRxiv - Genomics 2019Quote: ... 0.3 µL of 10 mM ATP (NEB) and 0.33 µL of nuclease-free water ...
-
bioRxiv - Microbiology 2019Quote: ... 10 U of RNase Inhibitor (Murine, NEB), 0.5 mM each dNTP mix and 5 mM DTT in a final volume of 10 μL ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 µM (nucleotide) linear φX174 dsDNA (NEB) was added to the mixture to initiate the three-strand exchange reaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μl 10mM ATP (New England Biolabs), 2 μl T4 ligase (New England Biolabs) ...
-
bioRxiv - Genetics 2020Quote: ... We added 10 µL rSAP (NEB #M0371L) and incubated at 37°C for 1 h to prevent plasmid re-ligation ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 U μL-1T4 Rnl2 (truncated) (NEB) and incubating for 3 hr at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 U of AMV reverse transcriptase (NEB) was added ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... coli DH 10-beta (New England Biolabs) was transformed with Gibson assembly product ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 U DpnI (New England BioLabs #R0176L) was added and sample processing continued as described [49].
-
bioRxiv - Cell Biology 2022Quote: ... 10 ul of 10X G5 buffer (NEB), and 1ul of Endo H HF (NEB) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10-100 nM M13mp18 scaffold (Bayou Biolabs) was incubated with an excess of staple strands (IDT) ...
-
bioRxiv - Cell Biology 2022Quote: ... A 10 μl Gibson ligation reaction (NEB) was performed using 5 ng of the gel-purified inserts and 12.5 ng of the vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli strain 10-beta (New England Biolabs) or TOP10 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and treated with 10 units RppH (NEB) and 30 units T4 PNK (NEB) ...
-
bioRxiv - Genetics 2022Quote: ... 10 U of T7EI ((M0302S, NEB, USA) was added and incubated at 37 ℃ for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs). Lysates were centrifugated at 14,000 g for 10 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl 50% PEG 8000 (NEB, M0242), 1 μl 40 U μl-1 RNase Inhibitor (NEB ...
-
bioRxiv - Physiology 2019Quote: ... 4 μl of 10% NP-40 (NEB) and 8 μl of PNGase F (NEB ...
-
bioRxiv - Systems Biology 2019Quote: ... 10 U of T4 DNA ligase (NEB) and 33µl of T4 DNA ligase buffer (10x ...
-
bioRxiv - Systems Biology 2019Quote: ... and 10 U of RNase H (NEB) with RNase H buffer (10X ...
-
bioRxiv - Cell Biology 2019Quote: ... A 10 μl Gibson ligation reaction (NEB) was performed using 5 ng of the gel-purified inserts and 12.5 ng of the vector ...
-
bioRxiv - Genetics 2019Quote: ... and 10 U DNA polymerase I (NEB), made up to a final volume of 50 μl with H20.
-
bioRxiv - Genomics 2019Quote: ... 10 mg/ml BSA (NEB, Ipswich, America), T4 DNA ligase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... MNase (10 Units/sample; New England Biolabs) was added and reactions were incubated for 40 min at 37°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli NEB 10-beta (New England Biolabs) was grown at 37 °C in LB medium supplemented with appropriate antibiotics as necessary for plasmid preparation ...
-
bioRxiv - Microbiology 2021Quote: ... 10 units of BstUI (Nex England Biolabs) were added to each reaction and incubation was conducted at 37°C for 3 h ...
-
bioRxiv - Genomics 2020Quote: ... 10 U T4-βGT (NEB, Ipswich, MA). The reaction was initiated by adding Fe (II ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µl 5x GC Buffer (NEB, USA), 1 µl dNTP mix (10 mM each ...
-
bioRxiv - Genomics 2021Quote: ... and 10 U T4 RNA Ligase1 (NEB). Reaction mixtures were incubated at 37°C for 2.5 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs), and centrifugated at 20,000 g for 2 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of enzyme (NEB, cat# R0543) was used in a 50 μl-reaction containing 5 μl of NEBuffer r3.1 (10X ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of 2% BSA (NEB B9000S), 2 μl of 20 U/mL SUPERaseIn ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10-beta cells (New England Biolabs) with 5 μl of the assembly mix according to the protocol provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 units T4 PNK enzyme (NEB) at 37 °C for 30 min.
-
bioRxiv - Genomics 2022Quote: ... 10 µL 25U/µL MboI (NEB, #R0147L) and 5 µL water were added to each tube and incubate at 37°C with rotation for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with 10 µL RNaseH (NEB # M0297S) for 30 min at 37°C.
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U of T4 Polynucleotide Kinase (NEB) and 40 U Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...
-
bioRxiv - Biophysics 2024Quote: ... 10 units of calf intestinal phosphatase (NEB), 5 units of antarctic phosphatase (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM ribonucleoside-vanadyl complex (NEB, S1402S)) and incubated overnight at 37°C in a humidified chamber ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 µl of 10× CutSmart buffer (NEB), 2.5 µl 100× Protease inhibitor cocktail and 1 µl of CviKI-1 (5 U/100,000 nuclei ...
-
bioRxiv - Bioengineering 2023Quote: ... Escherichia coli 10-beta (New England Biolabs) was used for plasmid construction ...
-
bioRxiv - Bioengineering 2023Quote: ... NEB 10-beta (NEB cat. no. C3019), or NEB Stable (NEB cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 U/mL of DNaseI (NEB, M0303S), 1x cOmplete™ protease inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2023Quote: ... 10 units of restriction enzyme XhoI (NEB) were added to the nucleosome array with and without PU.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RP1 primer (NEB), 1 µL ddH2O and PCR amplified for 16-18 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RPI primer (NEB), 2 µL 10 µM RP1 primer (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10×T4 ligase buffer (NEB), 0.2 μl 0.1 M ATP (Thermo Fisher) ...
-
bioRxiv - Genomics 2023Quote: ... restriction enzyme (10 units of HpyCH4IV [NEB] for PCR7 and PCR31 ...