Labshake search
Citations for New England Biolabs :
1401 - 1450 of 7397 citations for 6 Chloro 2 3 4 5 tetrahydro 7 8 dimethoxy 1 4 methoxyphenyl 1H 3 benzazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 5 U µL-1 T7 RNA polymerase (NEB) and 0.2 µg µL-1 template DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Genetics 2020Quote: ... A 6 µL mixture containing 2 µL of 40 µM Spy Cas9 NLS protein (New England Biolabs, MA, USA), 200 ng each of five sgRNAs (in 2 µL ...
-
bioRxiv - Physiology 2021Quote: ... 5’ end repair was done using T4 PNK with 2 mM ATP (NEB P0756S). Following RNA purification with Zymo Oligo Clean & Concentrator (D4060) ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified using a pre-poured amylose column containing 4 mL amylose resin (New England Biolabs, E8021L) followed by size exclusion chromatography (protein buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNA was first chemically fragmented (4 min) and then enzymatically treated with Antarctic Phosphatase (NEB#M0289S) and T4 Polynucleotide Kinase (NEB#M0201S) ...
-
bioRxiv - Immunology 2021Quote: ... 240 nM dT-primer* (Metabion, Planegg, Germany) and 4 U RNase Inhibitor (New England Biolabs, Frankfurt, Germany). Reverse transcription and addition of the template switch oligo was performed at 42 °C for 90 min after filling up to 10 μl with RT buffer mix for a final concentration of 1x superscript II buffer (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... The second aliquot was incubated overnight at 37 °C with β1-4 galactosidase (New England Biolabs #P0745) using the same reaction conditions as the neuraminidase above ...
-
bioRxiv - Neuroscience 2022Quote: ... Gelated samples were digested in 4 U/ml proteinase K buffer (New England Biolabs, Ipswitch, MA, USA) with 50 mM Tris pH 8.0 (Serva ...
-
bioRxiv - Cell Biology 2022Quote: ... Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: ... was digested for 4 h at 37 °C using the restriction enzyme BbsI (#R3539S, New England Biolabs) and run on a 1 % agarose gel for 3.5 h at 100 V ...
-
bioRxiv - Genomics 2021Quote: ... 4 μg of total RNA were reverse-transcribed by the M-MLV reverse transcriptase (New England BioLabs) following the manufacturer specifications and using oligo d(T ...
-
bioRxiv - Molecular Biology 2021Quote: ... Table 4 was end labeled using gamma-ATP and T4 Polynucleotide Kinase radioactive labeling protocol from NEB. Labelled oligos were purified using GE Healthcare illustra ProbeQuant G-50 Micro Columns and the membrane was probed overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were cooled to 4°C for 30 seconds and quenched with 1.2 mM unlabeled SAM (NEB) and blotted onto Hybond-XL membrane ...
-
bioRxiv - Molecular Biology 2023Quote: ... pull-down was performed with 100 μl pre-blocked (NETS buffer with 4 mg/ml BSA (NEB) and 2 mg/ml tRNA (SigmaAldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Ligation was performed for 4 h at 16°C using 10,000 units of T4 DNA ligase (NEB) in 1.2 mL of ligation buffer (120 μL of 10× T4 DNA ligase buffer ...
-
bioRxiv - Genomics 2023Quote: ... Nuclei were pelleted at 4℃ and washed once with cold 1.4 × NEB buffer 3.1 (NEB Cat#B7203S). Nuclei were then re-suspended in 25μl of 1.4 × NEB buffer 3.1 and treated with 0.1% SDS for 10min at 65℃ ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Genomics 2023Quote: ... beads were incubated with 10 µL of USER mix (1 µL of 10X USER buffer and 1 µL of USER enzyme in 8 µL of nuclease-free water, NEB) and incubated at 37°C for 15 minutes ...
-
bioRxiv - Genomics 2023Quote: ... an exonuclease treatment was carried out at 37°C for 1h with 10U of exonuclease I (NEB) in 1X exonuclease buffer (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... to 3 μM concentration in a total volume of 50 μl and mixed with 20 μl amylose beads (New England BioLabs). After mixing the proteins and the beads ...
-
bioRxiv - Microbiology 2021Quote: The chimeric CrPV-aNCV infectious clone was derived from the full-length CrPV infectious clone (pCrPV-3; Accession KP974707) (35) using Gibson assembly (New England BioLabs), per the manufacturer's instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 fragments have been inserted into pCS2+ plasmid linearized with Xho1 using the Gibson Assembly Cloning Kit (New England Biolabs): a first fragment of 4161bp of the ancBE4max to the PIM domain (amplified using the primers F-5’-CGATTCGAATTCAAGGCCTCATGAAACGGACAGCCGAC-3’ and R-5’-CGGTCTGGATCTCGGTCTTTTTCACGATATTC-3’) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sgRNA products synthesized by VSW-3 RNAP and T7 RNAP were purified with Monarch RNA Cleanup kit (New England Biolabs) and then further purified by high performance liquid chromatography (HPLC ...
-
bioRxiv - Cell Biology 2022Quote: ... an enzyme mixture of 3 μl in volume that contains 0.01 U Bst 2.0 DNA polymerase (New England Biolabs, United States), 0.5 U SplintR ligase diluted with Diluent A (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA (3 μg) was applied for poly(A) mRNA purification by using oligo-d(T) magnetic beads (S1419S, NEB). RNA fragmentation ...
-
bioRxiv - Biochemistry 2020Quote: ... Filters were then washed with 3 aliquots of 100 μL 50 mM ABC pH 8.0 before adding 1000U PNGase F (NEB #P0704) in 2M urea ...
-
bioRxiv - Microbiology 2020Quote: ... 5’ – GGA GAA AAC CTT TAC TTC CAG GG-3’ and 5’ – AAT GGA TCC CAG GGG CCC-3’ using the Q5 Site-Directed Mutagenesis protocol according to the manufacturer guidelines (New England Biolabs). Michael Malim (King’s College London ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Universal PCR primer for Illumina (5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC-s-T-3’) and NEBNext Index primer for Illumina (NEB, index# 9-13 for five libraries in each repeat) ...
-
bioRxiv - Molecular Biology 2019Quote: ... four point mutations were introduced in the 3′ exon of the tricRNA reporter (see Supplementary Figure S1) using Q5 Site-Directed Mutagenesis (NEB). For primer sequences ...
-
bioRxiv - Microbiology 2019Quote: ... This resulted in a SphI-end of TEF2 ORF-GFP-XhoI-NotI-TEF2 3’ flank-AatII fragment and a SphI-end of TEF2 ORF-mCherry-XhoI-NotI-TEF2 3’ flank-AatII fragment that were digested with SphI and AatII and ligated into pUC19 (NEB) to form pMBL183 and pMBL184 ...
-
bioRxiv - Genetics 2019Quote: ... with a KAPA Hyper Prep Kit (KAPA, kk8502) and then processed by 3 μl of USER™ Enzyme (NEB, M5505L) at 37°C for 15 min to open up the loop ...
-
bioRxiv - Cell Biology 2019Quote: The tcb3 gene including 500bp of the 5’ UTR and 100 bp of the 3’ UTR was amplified from purified genomic DNA using Phusion DNA polymerase (New England Biolabs). 5’Sal1 and 3’Sac1 restriction sites were introduced with amplification primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... and pSP64-eGFP-F-nos1-3’UTR (Weidinger et al., 2002) constructs were linearised with SacII and NotI restriction enzymes (NEB) respectively ...
-
bioRxiv - Genetics 2020Quote: ... 5’-CAA GCA GAA GAC GGC ATA CGA GAT-3’) and 20U/μl Q5 DNA Polymerase in 1X Q5 DNA polymerase reaction buffer (New England Biolabs). Reaction conditions were the same as Pre-Selection PCR ...
-
bioRxiv - Microbiology 2021Quote: The coding sequence of CTSL was tagged with a 3’V5 and cloned into CSIN using NEBuilder HiFi DNA Assembly (NEB) with primers CTSL_3’_V5_F ...
-
bioRxiv - Molecular Biology 2020Quote: ... Subcloned cells were screened for correct targeting by PCR amplification and restriction enzyme digestion (MCM10 exon 3, Hpy199III (NEB R0622); CDC45 exon 3 ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the clpP2 gene were amplified by PCR using the A–B and C–D primer pairs from table 3 (Phusion polymerase, GC buffer, New England Biolabs). The PCR products were purified with E.Z.N.A ...
-
bioRxiv - Biochemistry 2020Quote: ... These beads were then resuspended in equal amounts of PBS+ DNaseI digestion buffer with 3 ul (6U) of DNAseI (M0303S, NEB) and incubated at 37°C for 40min - 1h and separated by centrifuging at 2000 rpm for 2 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Either the wild-type or the mutant version of the PRNP 3’U R were inserted into the digested pmirGLO vector by performing a Gibson Assembly following manufacturer`s instructions (NEB). After transformation of the cloned vectors and purification of the DNA using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2021Quote: ... The flow cell was washed with water 3 times and then loaded with EcoRI-HF cocktail (1U EcoRI-HF (R3101, NEB) in 1X CutSmart NEB buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... and 3 kb of upstream sequence containing the promoter was amplified from Arabidopsis genomic DNA using Phusion polymerase (New England Biolabs) using flanking primers and then the primers RSH1-F (TCCGTCTTGTCTGAATCAGCT ...
-
bioRxiv - Plant Biology 2021Quote: ... and the 3’ UTR sequence (310 bp downstream of the stop codon) were amplified by PCR using Phusion DNA polymerase (NEB) from genomic Col-0 DNA with IRT1p_-1024F 5’- CACCGACACATTAAACATTCATACCCGATT-3’ and IRT1_1546R 5’- CTTTAATTTACTTATCTTGAAAAAGCAGC-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... designed to bind upstream of the polyA- tail at the 3’ end of the genome and dNTPs (10 mM, NEB), and incubated at 65 °C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNAs were isolated from Calu-3 infected cells 48h post infection using the Luna Cell Ready Lysis Module (New England Biolabs). Viral RNA were quantified by qRT-PCR in triplicate as described in [27] ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped with the addition of 0.2% SDS and 3 units of Proteinase K (New England Biolabs, #P8107S), and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers (5’-ACTAGTTCCGAGCTCGAG-3’) with restriction sites for SpeI and XhoI were introduced by PCR based mutagenesis using the Q5 mutagensis kit (NEB) after codon 466 of nsP2 (2EGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 ng of vector and 150 ng of each fragment were mixed with 3 μl of HiFi DNA Master Mix (NEB) and incubated at 50°C for 1 hour to form the new pCDH-TagBFP-T2A-myc-BirA*-Tensin3 construct ...