Labshake search
Citations for New England Biolabs :
1601 - 1650 of 7397 citations for 6 Chloro 2 3 4 5 tetrahydro 7 8 dimethoxy 1 4 methoxyphenyl 1H 3 benzazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Digestion into nucleosides was carried out on 3 μg aliquots using ‘nucleoside digestion enzyme mix’ from New England Biolabs (NEB#M0649) and incubated overnight at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Sox2 promoter was cloned by first removing the Ef1a promoter from the 3-SB-EF1-PBBAR-SB vector using NdeI (NEB, R0111) and SalI (NEB ...
-
bioRxiv - Genomics 2022Quote: ... PX458 and the synthetized SapI sgRNA expression cassette (IDT, find sequence in Table 3) were digested with KpnI (New England Biolabs, R3142S). Next ...
-
bioRxiv - Microbiology 2022Quote: ... Assembly of the two cDNA fragments was done using five overlapping cDNA fragments containing the VOC lineage defining mutations and replicon specific gene replacements (see Supplementary Table 3) using a NEBuilder® HiFi DNA Assembly Master Mix (NEB) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2022Quote: ... and pre-amplified for 14 cycles against a pool of primers (Supplemental Table 3) using PreAmp Grandmaster mix (TATAA Biocenter, Sweden #TA05) before exonuclease I treatment (New England Biolabs #M0293L). Pre-amplified cDNA was diluted at least 5-fold with nuclease-free water and mixed with SsoFast EvaGreen with Low ROX (BioRad #1725211 ...
-
bioRxiv - Genomics 2022Quote: ... Looped adapter sequences were opened by removal of uracil from hairpin structures by adding 3 units of USER enzyme (Uracil-Specific Excision Reagent) (NEB, M5505S) and incubation at 37 °C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total of 3 μg RNA was prepared for sequencing libraries using the NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB, USA) according to manufacturer’s instructions and sequences attributed to each sample by adding index codes ...
-
bioRxiv - Cell Biology 2023Quote: ... 5′-Phos-GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGUU[Biotin-dT]U[Biotin-dT]UUACACTCTTTCCCTACACGACGCTCTTCCGATC∗T-3′[∗phosphorothioate bond]) was then ligated at the free DSB ends with the quick ligase enzyme (NEB; M2200). After the primer ligation ...
-
bioRxiv - Biochemistry 2023Quote: ... and ATF4 5ʹ UTR-nLuc-3XFLAG mRNAs were co-transcriptionally capped with the 3’-O-Me-m7G(5ʹ)ppp(5ʹ)G RNA Cap Structure Analog (NEB # S1411S). All viral IRES nLuc-3XFLAG mRNAs were co-transcriptionally capped with the A(5ʹ)ppp(5ʹ)G RNA Cap Structure Analog (NEB # S1406S).
-
bioRxiv - Neuroscience 2023Quote: ... we introduced a silent mutation into the PAM motif of the sgRNA located within the 3’ homology arm in the donor plasmid by using Q5 Site-Directed Mutagenesis kit (NEB, E0054). The donor plasmid was confirmed with DNA sequencing ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a capture sequence at the scaffold of sgRNA for 10x feature barcode retrieval (cs1 incorporated at the 3’ end; (Replogle et al., 2020)) with use of NEBuilder HiFi DNA Assembly (NEB, E2621). sgRNAs were designed using CRISPick for CRISPRko (Doench et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The indicated oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Genomics 2022Quote: ... Approximately 3 μg of input DNA was dephosphorylated with alkaline phosphatase (ONT, cat SQK-CS9109) in CutSmart Buffer (NEB, cat B7204). Following enzyme inactivation of alkaline phosphatase ...
-
bioRxiv - Cell Biology 2022Quote: ... stop codon and 3’ T7 terminator were used as templates for the coupled in vitro transcription/translation PURExpress system (New England Biolabs, USA). The various SQS constructs used for cysteine crosslinking comprised an N-terminal 3xFLAG tag ...
-
bioRxiv - Microbiology 2023Quote: ... The 2X FLAG sequence was introduced via PCR as an oligonucleotide primer along with a reverse primer that produced the 3’ CNA1 UTR and cloned by use of the Gibson Assembly Cloning Kit (NEB #E5510S). The identity of the vector pCnat-CNA1-2X FLAG was also confirmed by sequencing.
-
bioRxiv - Systems Biology 2023Quote: ... 3) the wt bZIP sequences by digesting them out of them original plasmids with BamHI-HF (New England Biolabs, Ipswitch, MA) and SpeI-HF (New England Biolabs ...
-
bioRxiv - Plant Biology 2024Quote: ... and PE 2.0 (5′-CAA GCA GAA GAC GGC ATA CGA GAT CGG TCT CGG CAT TCC TGC TGA ACC GCT CTT CCG ATC* T-3′) for 15 cycles using Phusion polymerase (NEB M0530S). The library was purified by electrophoresis on a 1.2% agarose gel to get rid of adapter dimers ...
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix, NEB #E2621). The U6 promotor and the invariant scaffold are separated by a unique BsmBI restriction site using Q5® Site-Directed Mutagenesis Kit (NEB #E0554) ...
-
bioRxiv - Microbiology 2023Quote: ... A 3x HA-tag was fused to the C-terminal region of the amplified product along with the 3’UTR formed through Gibson assembly master mix (NEB, E2611S). To generate the PfMORC-HA knockdown constructs ...
-
bioRxiv - Cancer Biology 2023Quote: ... McGill University) and used to replace the mTurquoise of constructed 14-3-3ζ-mTurquoise using AgeI and NotI-HF (NEB; # R3189S). To conjugate Rluc8 to the N-termini of 14-3-3ζ ...
-
bioRxiv - Bioengineering 2023Quote: ... The transgene and sex of the F0 and F1 pups were determined by 3 PCRs of the Y chromosome using oligonucleotides described in Table S2 and LongAmp DNA polymerase (New England Biolabs, USA). Thermocycling conditions were as follows ...
-
bioRxiv - Genetics 2023Quote: ... n=16 ligations were performed using 300 ng of digested and dephosphorylated Trono-BR backbone and 3 ng of digested insert with high concentration T4 DNA Ligase (NEB #M0202M). The ligation reactions were precipitated using QuantaBio 5PRIME Phase Lock Gel tubes before being resuspended in 3 µL of EB Buffer per 4 precipitated reactions ...
-
bioRxiv - Cell Biology 2024Quote: ... The pRNA destination backbone was linearised by primers s5 and s6 (Table 3) and assembled with the mScarlet-I3 fragment using a NEBuilder® HiFi DNA Assembly kit (NEB) to create a pRNA-mScarlet-I3 destination vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Biochemistry 2023Quote: The library was ligated to the barcode oligonucleotide at a 7:1 oligo:library ratio overnight at 16 °C with T4 DNA ligase (New England Biolabs). A no-insert negative control was also ligated overnight using identical conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...
-
bioRxiv - Genomics 2020Quote: ... 8 units of SbfI and 8 units of HF-MseI (New England Biolabs, Frankfurt am Main, Germany). Digestion was performed at 37°C for 2 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting eluant was further treated with 1% SDS and 8 U/mL proteinase K (NEB, P8107S) at 42°C for 20 minutes then phenol chloroform extracted and ethanol precipitated.
-
bioRxiv - Biochemistry 2020Quote: ... Lysates were centrifuged at 30,597xg and 4°C for 20min and the supernatant was applied to amylose resin (NEB). The column was washed with 10 column volumes (CV ...
-
bioRxiv - Biochemistry 2020Quote: ... Vector and fragment were ligated in an overnight reaction at 4 °C using T4 DNA Ligase (New England Biolabs). After transformation ...
-
bioRxiv - Cell Biology 2021Quote: ... centrifuged at 58,000 × g for 50 minutes at 4°C and the protein was batch purified using chitin beads (NEB). Protein-bound chitin beads were washed with lysis buffer and high salt buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... The region of interest was amplified with specific primers (see Supplemental Table 4) and the Q5 DNA polymerase (NEB), and indexed by PCR using primers containing Illumina indexes (see Supplemental Table 4) ...
-
bioRxiv - Biophysics 2020Quote: ... T270 plasmid was digested by HpaI at 37°C for 4 hr in the CutSmart buffer (New England BioLabs) to place the (TTAGGG)270 at the middle region of the linearized substrate ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysate was cleared by centrifugation (20 min, 20,000 × g, 4°C) and protein was purified on amylose resin (NEB) including a high salt wash with buffer containing 25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Genomics 2022Quote: ... Next, 500 nL of MspJI digestion mix (1x NEBuffer 4, 8x enzyme activator solution, 0.1 U MspJI (NEB, R0661L)) was added to each well and the plates were incubated at 37°C for 4.5 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates were cleared via centrifugation at 30,597xg and 4°C for 20 min and the supernatant was applied to amylose resin (NEB). The column was washed with 15 column volumes (CV ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the Schizosaccharomyces pombe rad9 intron was synthesized via fusion PCR (4) and inserted between BamHI and PstI (NEB). The N ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated in fresh medium containing 4 μM SNAP-Cell TMR-Star (New England Biolabs, Inc.) for 15 min at 25°C ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed on 4 ng of pKD3 plasmid using Q5 High-Fidelity 2X Master Mix (New England Biolabs). The PCR product was digested for 1 hour with the restriction enzymes DpnI and ClaI at 37°C and then the PCR product was run on a 1% agarose gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... sequence in a reaction containing 40 ng/μl DNA (4 μg total) and 0.5 U/μl restriction enzyme (HindIII-HF; NEB, Cat ...
-
bioRxiv - Immunology 2021Quote: ... 5’ arm of homology to exon 5 of the Il22 gene was cloned into NotI-EcoRI-digested pMACs 4-IRES.II (contains EMCV IRES and truncated hCD4) using T4 DNA Ligase (NEB). Second ...
-
bioRxiv - Genomics 2022Quote: ... We then amplified barcodes from both cDNA and DNA in 4 PCR reactions per sample using Q5 (NEB #M0492) and primers specific to the reporter genes (GWLP P3 ...
-
bioRxiv - Genetics 2023Quote: ... digested pJFRC12-10XUAS-IVS-myr::GFP backbone using the following reactions conditions: 4 µL T4 ligase buffer (10x) (NEB), 20 µl plasmid backbone DNA (0.005 pmol) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNAs were eluted by mixing the beads with 21µl RNase H Elution Buffer and 4 µl RNase H (New England Biolabs) and incubated at 37 °C for 30 min while shaking ...
-
bioRxiv - Microbiology 2023Quote: ... Reactions were set up as per manufacturer’s instructions with the addition of 4 units of Murine RNase Inhibitor (NEB) and 5% DMSO ...
-
bioRxiv - Cell Biology 2023Quote: ... nuclei were collected by centrifugation at 800g for 10 minutes at 4°C and resuspended in 1.2 X of NEB buffer 2.1 (New England Biolabs, B7202). 1 x 107 nuclei were then solubilized with 0.3% SDS for one hour at 37°C followed by adding 1.8% of TritonX-100 and incubating one hour at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... mRNA was purified from 4 µg of total RNA with a magnetic mRNA isolation kit (New England Biolabs, S1550S). cDNA was synthesized from mRNA samples with M-MLV (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... The ligation of vectors with gRNA inserts was performed overnight at 4°C using T4 DNA ligase (NEB, M0202). The ligation products were then transformed ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...