Labshake search
Citations for New England Biolabs :
1351 - 1400 of 7397 citations for 6 Chloro 2 3 4 5 tetrahydro 7 8 dimethoxy 1 4 methoxyphenyl 1H 3 benzazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 min and then samples were incubated with ligation buffer (8 μl of 5x ligation stock (New England Biolabs, USA), 1 μl ligase and 31 μl of ultrapure water on each coverslip ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... The end-repaired DNA was ligated with 5 μl Adapter Mix (ONT, SQK-LSK110) using 8 μl NEBNext Quick T4 DNA ligase (NEB, E6056) at 21°C for up to 1h ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was buffer exchanged into enterokinase cleavage buffer (20 mM Tris pH 8, 50 mM NaCl, 2 mM CaCl2) and cleaved using bovine enterokinase (EK, NEB) at 16U/mg protein for 4 hrs ...
-
bioRxiv - Molecular Biology 2021Quote: ... after incubating the samples with 2 μl of RNase A (Thermo) at 37 °C for 2h and then with 8 μl of proteinase K (NEB) at 55 °C for 4h ...
-
bioRxiv - Immunology 2022Quote: ... 2018” tagmentation mix were either sorted into plates containing RCB buffer for condition “hiSDSprotK-TWEEN” (2 x RCB: 100 mM Tris-HCl pH 8, 100 mM NaCl, 40 µg/mL Proteinase K (NEB), 0.4 % SDS (Sigma ...
-
bioRxiv - Genomics 2021Quote: ... The PCR mix (8 µl H2O, 2 µl primer mix P5Solexa/P3Solexa, 10 µM each, 20 µl Phusion HF Mix [New England Biolabs]) was added to 10 µl cDNA ...
-
bioRxiv - Genomics 2021Quote: ... Fragmentation was carried out by adding 50 μL NEB Buffer 2 and 8 μL of 25 U/μL MboI restriction enzyme (New England Biolabs). Samples were incubated at 37 °C for 2 hours with rotation ...
-
bioRxiv - Genomics 2023Quote: ... 7 μL Q5 high GC enhancer (NEB), 0.07 μL 100mM dATP ...
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... RNA and 3′ adapters were incubated at 22°C for 2.5 hr with 51 U of T4 RNA Ligase I (NEB) and 12 U of recombinant RNase inhibitor (Takara Bio ...
-
bioRxiv - Neuroscience 2019Quote: Single nucleus RRBS were performed by first sorting PROX+/FOS+ and /FOS- neuronal nuclei in 96-well plates in 3 µL of 0.1× CutSmart buffer (New England Biolabs) per well as described in the Flow Cytometry section of the Materials and Methods ...
-
bioRxiv - Genetics 2022Quote: ... Pddx-23::ceDDX23::ddx-23 3’UTR (nEx2971 and nEx2972) was generated by HiFi DNA Assembly (New England Biolabs) of Pddx-23 ...
-
bioRxiv - Biophysics 2019Quote: ... These cDNAs along with cDNA of hRIC-3-pHEMH19 were linearized with the restriction enzyme NheI (New England Biolabs). Subsequently ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of genomic DNA was incubated with 3 µg of in vitro transcribed sgRNAs and 3 µg of purified Cas9 protein in 20µl of 1x NEB3 buffer (New England Biolabs) at 37°C over night ...
-
bioRxiv - Microbiology 2020Quote: pCrPV-3 and pCrPV-1A-DcDV-1A were linearized by digestion with BamHI-HF (New England Biolabs, Ipswich, Massachusetts). Wild-type and CrPV-DcDV RNA was prepared by in vitro transcription of 1 µg linearized plasmid using the mMESSAGE mMACHINE T7 transcription kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... unc-116::tagRFP::tom7 including unc-54 3’-UTR was PCR amplified using Phusion polymerase (NEB, Ipswich, MA, USA) from unc29p::unc-116::tagRFP::tom7 using following primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Par-3 PDZ1-APM and PDZ1-APMΔPDZ2 were first his-purified (described above) prior to incubation with amylose resin (NEB). Amylose-bound Par-3 was then washed and resuspended in binding buffer as described for GST proteins.
-
bioRxiv - Cell Biology 2020Quote: PCR amplification of short fragments for screening purposes (<3 kbp) was conducted using OneTaq® (New England Bolabs (NEB), Ipswich ...
-
bioRxiv - Systems Biology 2021Quote: ... 3 μL of the reverse phasing primer pool (100 nM) and 15 μL of Q5 Mastermix (New England Biolabs). Cycle conditions were 4 minutes at 98°C followed by 20x (30 seconds at 98°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The tubes were cooled at 42 °C for 10 min before addition of 3 μl of β-agarase (NEB) dissolved in 100 μl MES solution ...
-
bioRxiv - Genomics 2022Quote: ... and water to make up 49 µl) for three hours at 37°C after which 3 µl NlaII (NEB) was added and the reaction incubated at 37°C for a further three hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified mIL-12bC197S-His6 in complex with mIL-12Rβ1D1-D2-His6 was subjected to an overnight Caspase-3 and EndoH (New England Biolabs) digest (1/100 w/w ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 μL of Round1 barcode mix (1x T4 DNA ligase buffer, 16 M/μL T4 DNA ligase (M0202L, NEB), 0.25 M/μL RNase Inhibitor ...
-
bioRxiv - Microbiology 2023Quote: ... RNA and 3′ adapters were incubated at 22°C for 2.5 hr with 51 U of T4 RNA Ligase I (NEB) and 12 U of recombinant RNase inhibitor (Takara Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were then incubated at 42°C overnight with the addition of 3 μl of β-agarase (NEB). The DNA mix was then gently poured into combing reservoirs containing 1.2 ml MES and the genomic DNA was combed onto salinized coverslips (Genomic Vision ...
-
bioRxiv - Molecular Biology 2023Quote: ... The extracted chromatin was digested for 3 hours at 37 °C in a volume of 250.0 μL with 100 U of NlaIII (NEB) for 3C library preparation ...
-
bioRxiv - Microbiology 2023Quote: ... Fragmented RNAs were then dephosphorylated at their 3’ end using T4 Polynucleotide kinase (PNK, New England Biolabs, Cat: M0201) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Cancer Biology 2023Quote: ... adenosines were added to the 3′ ends of dsDNA and adapters were ligated (adapters from NEB, Ipswich, MA, USA). Following the adapter ligation ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified supernatant was then batch-bound for 3 hours on to 20 mL chitin resin (New England Biolabs) equilibrated with 200 mL of cell lysis buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... a DNA adapter (TableS6) was ligated to 3′ ends of nascent RNA using the T4 RNA ligase kit (NEB) by mixing 50 pmol adapter with 300-600 ng nascent RNA ...
-
bioRxiv - Genetics 2023Quote: ... 100 ng of genomic DNA was digested with 5U of BtsCI in a 3 μl reaction (New England Biolabs), 1 hour at 50°C incubation and no enzyme denaturation ...
-
bioRxiv - Microbiology 2023Quote: ... hysA (SAA6008_RS12255) and vigR 3’ UTR from JKD6008 were in vitro transcribed (IVT) using HiScribe T7 RNA polymerase (NEB). IVT products were RQ1 DNase treated (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... and the newly formed CENP-A was pulse labelled with 3 μM SNAP-Cell® 647-SiR (S90102S, NEB), 2 h after release from the STLC block (early G1) ...
-
bioRxiv - Cell Biology 2023Quote: The 3’ ends of the ribosome footprint RNA fragments were treated with T4 polynucleotide kinase (New England Biolabs, M0201) to allow ligation of a pre-adenylated DNA linker with T4 Rnl2(tr ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1X Protoscript II buffer (50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2) 40 U Murine RNase Inhibitor (NEB), 5 mM DTT and pre-incubated for 10 minutes at 42 °C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 20 µL of denatured protein lysate was combined with 2.5 µL of 10X GlycoBuffer 3 (Cat.#B1720S; New England Biolabs) and 2.5 µL of Endo Hf in a total reaction volume of 25 µL ...
-
bioRxiv - Neuroscience 2023Quote: ... One piece of brain tissue (∼300 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 8 mM rNTPs (NEB #N0466S), 250 U T7 RNA Polymerase (NEB #M0251L ...
-
bioRxiv - Biophysics 2023Quote: ... 8 μl XhoI (NEB, R0146S) and 8 μl DpnI (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of DNA was mixed with 7 µl NEBNext Ultra II end prep reaction buffer (NEB) and 3 µl Ultra II end prep enzyme mix (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of 5 µM RA3 adapter (NEB) was added to 5 µL RNA sample ...