Labshake search
Citations for New England Biolabs :
1351 - 1400 of 5199 citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... extracted PCR product with 2 μl of NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Molecular Biology 2024Quote: ... were directly added to the beads and incubated at 70 °C for 2 min before 7.8 µl of ligation master mix (0.097% RNA ligase buffer (NEB), 1.94 mM DTT ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared by mixing 25µL of NEBNext High-Fidelity 2× PCR Master mix (M0541, New England Biolabs), 21µL CUT&Tag DNA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... as follows: 20 μL reactions were prepared using 2 μL 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S), nuclease-free water ...
-
bioRxiv - Genomics 2024Quote: ... and 3.2 µl of PCR mix (1.5× Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs), 0.15% Tween-20 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μg of a construct encoding eGFP-nanos3’UTR was digested using NotI-HF (New England BioLabs, R3189S) for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 1:1 combination of oligodT 18 primers and random hexamers (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl 10× T4 PNK buffer and 1 μl T4 PNK enzyme (NEB) at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of BsaI-HFv2 and 1 μl of T4 DNA ligase (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... RNase H diluted (1:100) in 1× RNase H buffer (New England Biolabs) was added to the cells and incubated for 2 h at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 120 nM fluorescent beacon and 1 U.μL-1 murine RNase Inhibitor (NEB M0314) in the reaction buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μl of DNAse I at 1 mg/ml (NEB, cat no. M0303L), 1 μl RNAse at 10mg/ml (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The reaction was further adjusted with dTTP (1 µl, 1 mM) (NEB #N0443S), TdT reaction buffer (1 µl) ...
-
bioRxiv - Biophysics 2024Quote: ... a 1 μL portion of a 1 mg/mL stock of trypsin (NEB Trypsin-ultraTM ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the resulting cell pellet was resuspended in 1 mL of RNA Protection Buffer (1× NEB DNA/RNA Protection Reagent, 1% (w/v) polyvinylpyrrolidone-40 ...
-
bioRxiv - Genomics 2023Quote: ... and incubated at 37°C for 1 hour with RNase A/T1 (Thermo, 1/20 volume) and RNase H (NEB, 1/50 volume). The DNA was then purified again.
-
bioRxiv - Microbiology 2020Quote: ... purified and ligated for 2 h at room temperature using the Instant Sticky-end Ligase Master Mix (NEB, Australia) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified using the Luna Universal Probe Onestep RT-qPCR kit (New England Biolabs) and US CDC real-time RT-PCR primer/probe sets for 2019-nCoV_N1 ...
-
bioRxiv - Genetics 2021Quote: Cells from each fin sample obtained as described before were washed in 2 ml PBS supplemented with 0.1% bovine serum albumin (BSA) (NEB). Each sample was divided into two replicate tubes ...
-
bioRxiv - Microbiology 2020Quote: ... These gBlocks fragments and a NdeI-HindIII-digested pET21b backbone were assembled using a 2× Gibson master mix (NEB). Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and then a final extension at 72°C for 2 minutes using Q5 High-Fidelity Polymerase (New England BioLabs). We conducted a nested PCR to sequence exon 2 (204bp ...
-
bioRxiv - Biophysics 2022Quote: ... both were mixed (∼5μM acceptor strand and ∼2 μM phosphorylated donor strand in a final volume of 19μl) in T4 RNA ligation buffer (New England BioLabs) supplemented with 1mM ATP (New England BioLabs) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved in 70% EtOH at -20°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 1.5 mg of protein was cleaved in a 2 ml reaction with 240 Units of TEV protease (NEB) for two hours at 30 °C ...
-
bioRxiv - Genetics 2021Quote: ... 53.5 μl of cut 3C library was mixed with 6.5 μl NEBNext FFPE Repair Buffer and 2 μl NEBNext FFPE Repair Mix (New England Biolabs), followed by incubation at 20°C for 15 minutes and addition of 3 volumes of AMPure XP beads for purification.
-
bioRxiv - Plant Biology 2020Quote: ... A 3 μl aliquot of the purified DNA fragments was blunted in a 20 μl reaction containing 2 μl buffer 2.1 (New England Biolabs), 1 μl 2 mM dNTPs ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... and assembled with oncocin and true negative oligo inserts (Supplementary Table 2) with NEBuilder® HiFi DNA Assembly (NEB), and cloned in 5α E ...
-
bioRxiv - Bioengineering 2021Quote: The LAMP reagent mix in a total volume of 25 μL contained 12.5 μL of WarmStart or Colorimetric WarmStart 2 × Master Mix (New England BioLabs) or Bsm polymerase (Thermo Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... non integrated plasmids were cut by 2 h digestion at 37 °C with I-CeuI restriction enzyme (NEB, R0699S) in a total volume of 70 ul followed by 20 minutes heat inactivation at 65 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Pre-hybridization Buffer was replaced with 250 μl of Hybridization Buffer (2x SSC, 10% deionized formamide, 0.1% Tween-20, 2 mM vanadyl ribonucleoside complex (New England Biolabs), 100 μg/mL salmon sperm DNA (Invitrogen) ...
-
bioRxiv - Physiology 2021Quote: ... with 2 mL freshly prepared TST buffer (0.03% Tween 20 [Bio-Rad], 0.01% Molecular Grade BSA [New England Biolabs] ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 2 μl of the circularized product was then used for PCR amplification using Phusion High-Fidelity DNA Polymerase (NEB) for a maximum of 16 cycles ...
-
bioRxiv - Bioengineering 2021Quote: 2 μl of genomic DNA was used to amplify strain barcodes by PCR (Q5 NEB master mix, 22 cycles) using primers containing sequence-optimized spacers to maximize nucleotide diversity in Illumina sequencing ...
-
bioRxiv - Systems Biology 2020Quote: ... We discarded the supernatant and resuspended the pellet in 2 mL of 1x NEB buffer 3.1 (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... 40 μL purified supernatant were combined with 2,500 units recombinant glycerol-free PNGase F and Glycobuffer 2 (New England Biolabs) following the manufacturer’s protocol for non-denaturing digestion and incubated at 37°C for 5 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... The pellet was dissolved and digested in 50 ml buffer A with 2 mM CaCl2 and 4,000 units of micrococcal nuclease (M0247S, NEB) at RT for 20 min ...
-
bioRxiv - Bioengineering 2022Quote: ... 2 ul of cDNA without dilution was used for each PCR reaction by Phusion® HighFidelity DNA Polymerase (NEB) for 35 cycles ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 μg of supercoiled plasmid DNA was incubated at 37 °C for 3 hours with purified SpRY protein at a final concentration of 1 μM and IVT gRNA (prepared without DNase treatment) at a final concentration of 2 μM in Buffer 3.1 (NEB). Reactions were stopped by the addition of 1 μL of Proteinase K (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at 37°C and purified using Monarch® DNA Gel Extraction Kit (T1020S, New England Biolabs) before digestion-ligation with the gRNA-pScaffold-H1 using FastDigest Esp3I and T7 Ligase (M0318L ...
-
bioRxiv - Biochemistry 2021Quote: ... The reactions were stopped by addition of 2 μl of no SDS-purple gel loading dye (New England BioLabs) or 50% glycerol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Genomics 2021Quote: ... and permeabilized for 5 min on ice in PBS containing 0.5% Triton X-100 and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved in 70% EtOH at −20 °C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Genetics 2021Quote: ... Cells were fixed in 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2 mM Vanadyl-ribonucleoside complex (New England Biolabs). Coverslips were stored in −20°C in 70% EtOH until further use.
-
bioRxiv - Genetics 2021Quote: ... We added 1 µL 12.5% Triton-X to each well to quench the SDS and 12.5 µL NEBNext High-Fidelity 2× PCR Master Mix (NEB). Samples were PCR-amplified (72 °C 5 min ...