Labshake search
Citations for New England Biolabs :
1301 - 1350 of 5199 citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids coding for segments 2 and 8 were digested using BbsI restriction enzyme (New England Biolab, NEB), the plasmid coding for segment 10 was linearized with BsaI (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... and an additional hour after the addition of 2 U/ 50 µl of DNase (New England Biolabs, Inc.). The RNA samples were purified using an 8% Acrylamide:Bis-Acrylamide (29:1 ...
-
bioRxiv - Molecular Biology 2020Quote: Biotinylated DNA pellets were re suspended in 25μl TNE0.2 buffer (200mM NaCl, 10mMTris-HCl 7.5, 1mM EDTA) and mixed with 25μl Streptavidin coated magnetic beads (NEB, pre washed in TNE0.2 and blocked with 100μg/ml salmon sperm DNA) ...
-
bioRxiv - Neuroscience 2020Quote: ... A cDNA amplification mixture was prepared by adding 5µl of the resulting first strand cDNA with 7.5µl of OneTaq HS Quick-load 2× (NEB, #M0486L) and 2.5µl water ...
-
bioRxiv - Genomics 2020Quote: ... [2] Libraries prepared using the cf-RRBS protocol were cleaned by magnetic bead selection (AMPure XT beads – NEB) and eluted in 0.1X TE buffer ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation: TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Each sample was first treated with DNase I (New England Biolabs; 2 μL and 25μL of DNaseI buffer) for 1 h at 30 °C to remove any extracellular plasmid DNA ...
-
bioRxiv - Genetics 2022Quote: ... N is for a random nucleotide) were ligated to the small RNA by T4 RNA ligase 2 (NEB) and T4 ligase 1 (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... of 0.1M sodium hydroxide: 0.02M 2-(n-morpholino) ethanesulfonic acid (MES) or 1X NEB DNase I reaction buffer (NEB B0303S ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM CaCl2 and the TRX-6His-S-tag was cleaved overnight at RT with enterokinase protease (NEB). The ET domain was further purified using Nickel-NTA resin (Thermo Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... The reactions were then stopped by 2 μl of no SDS-purple gel loading dye (New England BioLabs) and separated on 0.6% agarose gel at 100V for 50 min in 1XTBE ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human recombinant histone H2A/H2B dimer (1.5 μg, 54 pmol) and histone (H3/H4)2 tetramer (1.5 μg, 27 pmol) (New England BioLabs) were mixed with the linearised 601 DNA fragments (6 μg ...
-
bioRxiv - Genetics 2020Quote: ... and multiplex barcoded with NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 2) (NEB, Ipswich, USA). An Illumina MiSeq device (Illumina Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... Standard curve was prepared using SARS-CoV-2 Positive Control plasmid containing full nucleocapsid protein (N gene) (NEB) and used to quantify copies of N gene in organoid samples ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µL NEB Ultra II End-prep Enzyme Mix and 2 µL NEBNext FFPE DNA Repair Mix (NEB) were added to the DNA (final volume 60 µL) ...
-
bioRxiv - Biochemistry 2020Quote: ... Fragments were created by PCR with the relevant primers (listed in Supplementary Table 2) using Q5 polymerase (NEB) and genomic DNA templates obtained from the Liebniz Institute [dsmz.de] ...
-
bioRxiv - Microbiology 2020Quote: The RNA was ligated to 10.7 pmol barcode DNA linker using 200 U T4 RNA ligase 2 (NEB) overnight at 16 °C ...
-
bioRxiv - Genomics 2020Quote: ... [2] Libraries prepared using the cf-RRBS protocol were cleaned by magnetic bead selection (AMPure XT beads – NEB) and eluted in 0.1X TE buffer ...
-
bioRxiv - Microbiology 2021Quote: Expression plasmids (Supplementary Table T 2) were cloned by isothermal assembly using NEBuilder HiFi DNA Assembly Mix (NEB). Plasmids were transformed into E ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant solution was incubated for at least 2□h with amylose-affinity chromatography resin (New England Biolabs), whilst gently shaking at 4□°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The reaction was incubated at 37°C overnight and stopped by adding 2 Units of DNase I (NEB) and incubating at 37°C for 15 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 ng of total RNA was mixed with 2 µL of random primer mix (New England Biolabs, UK) in RNase free PCR strips (Thermo Fisher ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was digested for 2-3 hours at 37°C with StuI or SphI restriction enzymes (NEB), as indicated in the figure legends ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621). The resulting plasmid will be referred to as pBd-phoD-HA-BSD.
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621). The homology and guide RNA were inserted as described for pBdEF-Cas9-BSD-phodR ...
-
bioRxiv - Genomics 2023Quote: ... the oligo pool for each library was amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Genomics 2023Quote: ... Approximately 7,500 cells were diluted with 1.25 ml of a dilution buffer containing 0.4x NEBuffer 2 (NEB, B7002S), 2 mg/ml BSA (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... with the inserts at 2 fold molar excess followed by multiple transformations into NEB stable competent E.Coli (NEB) to ensure at least 20x coverage of colonies for every sgRNA ...
-
bioRxiv - Bioengineering 2023Quote: All qPCR reactions were set up using 7.5 µl of 2 x Luna Universal qPCR master mix (NEB), 0.375 pmol forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then digested by adding 2μL LysC (500ng/μL, Pierce) for 2 hours then 6μL trypsin (100ng/μL New England Biolabs) overnight ...
-
bioRxiv - Physiology 2023Quote: ... muGFP and homology arms were PCR-amplified using Q5 High-Fidelity 2× Master Mix (New England BioLabs, M0492L). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Cell Biology 2023Quote: ... beads were equilibrated in 1x PMP buffer (50 mM HEPES, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, pH 7.5; New England Biolabs). Kinase reactions were performed with 1 μL commercial CK1δ (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... To a 10 μL aliquot of the supernatant were then added 2 μL of loading dye (NEB, #B7021S) and 1 μL of 2% sodium N-dodecanoylsarcosinate ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed the SNAP-tag labeling in vivo with 2 μM SNAP-Cell TMR-Star (New England Biolabs) and visualized histones incorporated into chromatin after a pre-extraction of soluble histones before fixation with 2% paraformaldehyde for 20’ as 32 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... extracted PCR product with 2 μl of NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... These two oligos were ligated with splint oligo1 at 37°C for 2 hours using T4 ligase (NEB; 1U/ml T4 DNA ligase and 13 T4 DNA ligation buffer) ...
-
bioRxiv - Molecular Biology 2024Quote: ... were directly added to the beads and incubated at 70 °C for 2 min before 7.8 µl of ligation master mix (0.097% RNA ligase buffer (NEB), 1.94 mM DTT ...
-
bioRxiv - Microbiology 2024Quote: ... all phages were treated with 2 uL of RNAase A (50,000 U/mL, New England BioLabs, Cat. M02403S) and 50 uL of NEB buffer ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA adenylated oligonucleotide adenylate intermediate was de-adenylated (RNA sample, NEB Buffer 2, and 5’-deadenylase (NEB); incubation at 30 °C for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared by mixing 25µL of NEBNext High-Fidelity 2× PCR Master mix (M0541, New England Biolabs), 21µL CUT&Tag DNA ...