Labshake search
Citations for New England Biolabs :
1251 - 1300 of 5199 citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 100 μM ATP including 1 unit/μL T4 RNA ligase 1 (NEB) (final volume 300 μL ...
-
bioRxiv - Microbiology 2023Quote: ... In vitro Xrn-1 digests were performed with 1U Xrn-1 (NEB), 10U RppH (NEB) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM EDTA) and 1 mg of hydrophilic streptavidin magnetic beads (NEB) equilibrated into the same buffer ...
-
bioRxiv - Genomics 2022Quote: ... 1× CutSmart Buffer (NEB) and 15 units of Quick CIP (NEB ...
-
bioRxiv - Genomics 2022Quote: ... 1× CutSmart Buffer (NEB) in nuclease-free water to form RNPs ...
-
bioRxiv - Genomics 2020Quote: ... and NEBuffer 1 (NEB) to the library and incubated at 37 °C for 1 hour ...
-
bioRxiv - Genetics 2021Quote: ... rSAP (1 Unit, NEB) and RNasin (20 units ...
-
bioRxiv - Genetics 2020Quote: ... 1:50 (NEB, 14001), (5 ...
-
bioRxiv - Genetics 2020Quote: ... 1:100 (NEB, 51255), (4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ligase 1 (NEB) sequentially ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mM ATP (NEB), 1×T4 DNA Ligase Buffer and 800 U T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... 1× Buffer 2.1 (NEB), 2 µg BSA and 3 units of T4 DNA polymerase (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... coli Topoisomerase 1 (NEB), 0.1 mg/ml BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl MlyI (NEB). The digest was incubated at 37°C for 1 hour ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM NAD+ (NEB) and water to a volume of 20 μl ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl RNaseOut (NEB), 2 μl of 100 μM TSO ...
-
bioRxiv - Genomics 2023Quote: ... 1 mM ATP (NEB), 4 mM DTT (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µl DpnI (NEB) was added to the PCR mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... after DNase 1 (NEB) treatment.
-
bioRxiv - Genomics 2024Quote: ... 1% BSA (NEB, B9000S), and 1U/ml Protector RNase Inhibitor (between 100-200 μl depending on pellet volume) ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mM NAD+ (NEB), 4 µg of DNA or RNA oligo ...
-
bioRxiv - Genomics 2023Quote: ... and 1× Thermopol (NEB) at 72°C for 60 min ...
-
bioRxiv - Genomics 2022Quote: ... 1 mM dNTPs (NEB), 1 U/μL RNase Inhibitor (NxGen ...
-
bioRxiv - Molecular Biology 2023Quote: ... pyogenes (1 μl, NEB), and 0.2 µl phenol red were mixed in an Eppendorf tube (total volume 2.2 μl ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µl ExoI (NEB) and incubated for 1 h at 37°C followed by heat inactivation of 20 min at 80°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... with GlycoBuffer 1 (NEB) was added.
-
bioRxiv - Genomics 2024Quote: ... 1 μL NAD+ (NEB), 1 μL dNTP mix (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... apyrase (1 unit NEB) was added for an additional 1.5 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... Apyrase (1-unit, NEB) was then added ...
-
bioRxiv - Molecular Biology 2024Quote: ... Apyrase (1 unit, NEB) was added for an additional 1.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the manufacturer’s protocol or with radioactive labeling mix (1 µL 10x PNK buffer, NEB, 1 µL of 100 µM gapmer, 1 µL T4 PNK, NEB, 1 µL γ-32P-ATP, Hartmann, 6 µL ddH2O) for 40 min at 37°C ...
-
bioRxiv - Physiology 2024Quote: ... 5 flies were sorted into sterile microcentrifuge tubes and homogenised in 200 µl lysis buffer (1 X TE, 1 % Triton X-100, 1/100 proteinase K (NEB, P8107S)) using a mechanical pestle ...
-
bioRxiv - Bioengineering 2024Quote: ... and phosphorylated (1 μL 100 μM F oligo, 1 μL 100 μM R oligo, 1 μL T4 ligase buffer (NEB, B0202S), 1 μL T4 PNK (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 100 ng of unlabeled crRNA was mixed with equal volume of 2 × RNA loading dye (New England Biolabs) and fractionated in the 12% denaturing polyacrylamide gel ...
-
bioRxiv - Cell Biology 2020Quote: ... MNase (non-specific DNA digestion) used MNase buffer and 2 μL of enzyme (20 units/μL) PvuII (NEB), AluI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were deglycosylated with PNGase F by adding 5μl of a solution consisting of 18μL of Glycobuffer 2 (10x) and 27μL of PNGaseF (NEB, P0708S). Endoproteinase Lys-C (Promega) ...
-
bioRxiv - Genomics 2020Quote: ... After 2 rounds of SPRI cleanup the libraries were eluted in EB buffer and USER enzyme mix (NEB) was used to digest the second strand cDNA ...
-
bioRxiv - Genomics 2021Quote: ... phage particles were lysed at 56 °C for 2 h in 550 μL of lysis buffer (100 mM Tris-HCl at pH 8.0, 27.3 mM EDTA, 2% SDS, ~1.6 U Proteinase K [NEB #P8107]). After lysis ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were incubated with 2 nM benzylguanine-Alexa Fluor 647 (New England Biolabs, SNAP-Surface Alexa Fluor 647) or custom synthesized SNAP substrate benzylguanine-DY549P1 for 30 min before an experiment ...
-
bioRxiv - Plant Biology 2021Quote: ... transposed DNA was PCR amplified with 12 cycles using Next High-Fidelity 2×PCR Master Mix (NEB, M0541) with Nextera DNA CD Index primers ...
-
bioRxiv - Systems Biology 2020Quote: ... The purified transposed DNA was amplified with NEBNext High-Fidelity 2 X PCR Master Mix (New England Biolabs) and custom-designed primers with barcodes.30 Gel electrophoresis was used to remove primer dimers from the PCR products with 2% E-Gel EX Agarose Gels (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... After digestion the plasmid vector and insert were added to Gibson assembly master mix (1.5 µl insert, 0.5 µl vector, 2 µl master mix) (New England BioLabs) and incubated at 50 °C for 1 hr ...
-
bioRxiv - Microbiology 2021Quote: ... and was then installed with 5’cap (Vaccinia Capping System, NEB, USA; Cap 2’-O-methyltransferase, NEB, USA) and 3’ Poly(A ...
-
bioRxiv - Microbiology 2020Quote: ... proteins were pre-treated with 0.5 mM ATP and 2.5 U casein kinase 2 (CK2) in 1X CK2 buffer (NEB) for 15 min at 30°C ...
-
bioRxiv - Immunology 2022Quote: T7 endonuclease I digestion: 200 ng of purified DNA amplicons were annealed with 1X NEBuffer 2 (NEB, # B7002S) and total volume was brought up to 19 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μL of 2 mM dNTP and 0.5 μL (2.5 U) of DNA polymerase I Klenow fragment (New England Biolabs) were added to the reaction mixture ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Immunology 2022Quote: ... Final amplification PCR was performed as described before by adding 8 µl of 2 x PCR MM (NEB) with number of cycles according to qPCR (usually Cq values were around 20) ...