Labshake search
Citations for New England Biolabs :
1251 - 1300 of 4668 citations for 6 Hydroxy 4 trifluoromethyl 2 3' bipyridine 5 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... The fragmented RNA was 3’-end repaired using T4 PNK (NEB) and ligated to RNA adapter (5’-/5rApp/AGATCGGAAGAGCGTCGTG/3SpC3/-3’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... The DCR1 ORF along with its upstream and downstream sequence was amplified (primers: DCR1-Intergenic-For 5′-CCCCCTCGAGTTTGTAAAGAAATTGATGCTTCG; DCR1-Intergenic-Rev 5′-TGCAGGATCCGAATCTGGTATGGGATCATATTGG) and inserted between the XhoI and BamHI (NEB) restriction sites of pRS402.
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped by incubating at 65°C for 5 min followed by addition of 5 mM MgCl2 and 0.5 units of Shrimp Alkaline Phosphatase (rSAP, NEB M0371S). The phosphatase reaction was incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... RJ-167-mer and RJ-5’Tail-167mer were radiolabeled with 32P at the 5′-end using T4 Polynucleotide Kinase (NEB). To generate the 3′ Tail and dsDNA DNA substrates ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2019Quote: ... The AGO1 ORF along with its upstream and downstream sequence was amplified (primers: AGO1-Intergenic-For 5′-GCTGGAGCTCTGAACGTGTGGAAGACCAAA; AGO1-Intergenic-Rev 5′-ATGACTCGAGAGTGGCTAACGGCAACATATC) and inserted between the SacI and XhoI (NEB) restriction sites of pRS404 ...
-
bioRxiv - Microbiology 2021Quote: ... forward and reverse primer for GFP (forward 5’TCGACAGTCAGCCGCATCT3’ and reverse primer 5’CCGTTGACTCCGACCTTCA3’) respectively using 1μl taq polymerase (NEB, USA). The PCR amplification was performed as per the following cycle ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...
-
bioRxiv - Systems Biology 2020Quote: ... and at least 1 μg but no more than 5 μg DNA was put into an end-resection reaction (5 U T4 DNA Polymerase, NEB) to remove biotin from unligated ends ...
-
bioRxiv - Microbiology 2021Quote: ... Linearized DNA was purified by phenol/chloroform extraction and RNA was in vitro transcribed in the presence of G(5’)ppp(5’)G RNA Cap structure analog using SP6 polymerase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... The F1 progeny of the injected animals were selected for the roller phenotype and screened by PCR (forward primer 5’ TTGGAAGTGTTCGGTTACAAAA; reverse primer 5’ AAACTAAAATTGGCACGAAACG; IDT) and NcoI restriction digestion (New England Biolabs). Non-roller ...
-
bioRxiv - Genomics 2022Quote: Add 5 μl of dNTP mix (10 mM each) and 5 μl of DNA polymerase I Klenow fragment (NEB, M0210) to the reaction system ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NNN spacer to increase library diversity during sequencing (preadenylated oligos were prepared by 5’ DNA adenylation kit (E2610L) using thermostable 5’ App DNA/RNA ligase (M0319L, both from New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1 ...
-
bioRxiv - Microbiology 2023Quote: ... and ligating 5 µL of 5 µM spacers (annealed oligos) with 80ng of BsaI-digested backbone using the T4 ligase (NEB). We chose spacer sequences based on protospacer position and their association with a 5’-AAG-3’ motif and annealed them from two oligonucleotides with the according restriction site overhangs (95 °C for 5 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Molecular Biology 2023Quote: The nascent RNAs bound to Streptavidin Dynabeads were 5’ de-capped by diluting in RNA 5’ Pyrophosphohydrolase (RppH) mix (NEB) and incubation at 37 °C for 45 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... BSP1 was amplified from genomic DNA with primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgttacacgcgtgttggaagttttcttc while pCoofy3 was linearized with primers 5’-cgccattaacctgatgttctgggg and 5’-gggcccctggaacagaacttccag using Q5 High-Fidelity 2X Mastermix (New England Biolabs). After DNA fragments were purified from agarose gel ...
-
bioRxiv - Microbiology 2023Quote: ... Second DNA adapters (containing 5 [N5] or 10 [N10] random bases at the 5′-end) were ligated to the 5′-end of the cDNA (T4 RNA Ligase, NEB). The DNA was amplified by PCR and purified with PippinPrep system (Sage Science ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 µl NEB CutSmart buffer (NEB, B7204) in a reaction volume of 50 µl for 3 hrs at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 5 units of LongAmp taq DNA polymerase (NEB) and 50 ng of DNA sample extracted from infected cells in a 50 ⍰l final reaction volume ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 10 U/uL of 5’ deadenylase (NEB M0331S), 10 U/uL Rec J exonuclease (Epicentre RJ411250) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and MseI to generate 5’ TA overhangs (NEB). After dephosphorylation ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% (v/v) Ribonucleoside Vanadyl Complex (NEB)) at 4°C for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% (v/v) Ribonucleoside Vanadyl Complex (NEB)) and homogenized centrifuged at 15.000 g at 4°C.
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μl 10X standard buffer (New England Biolabs), 0.5 μl of each primer (10 mM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and uridine-5’-triphosphate (UTP) (New England Biolabs); and 640 µM S-adenosylmethionine (SAM ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μl 10X CutSmart Buffer (New England Biolabs), 10 μl 10mM ATP (New England Biolabs) ...
-
bioRxiv - Immunology 2021Quote: ... Uracil-DNA glycosylase (NEB, #M0280S, 5 U/ul) was added and the reaction was incubated for 1 h at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 units of Klenow DNA polymerase (NEB) to 80 µL of repaired mononucleosomal DNA to a final reaction volume of 120 µL ...
-
bioRxiv - Neuroscience 2020Quote: ... or α2-3,6,8 Neuraminidase (5 U/ml; NEB) for 2 hours before motoneurons were added (Supplementary Figure 7).
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl 5’Ligation Reaction Buffer (NEB-kit) and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μM dNTP (New England Biolabs, # N0446S) in 17.5 μl 1x CutSmart buffer (New England Biolabs ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 mg/mL purified BSA (NEB, G9001S), to prevent non-specific interaction of Cy5-eIF4E with the chip surface ...
-
bioRxiv - Molecular Biology 2022Quote: ... and processed with 5 units of T7EI (NEB) for 1 hour at 37 °C before resolved on 10% TBE PAGE gels (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... add 5 μL Proteinase K (New England BioLabs), scrape cells from 24-well ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 5 μl T4 Ligase Buffer (NEB, B0202), 400 units T4 Ligase (NEB ...
-
Spatial rearrangement of the Streptomyces venezuelae linear chromosome during sporogenic developmentbioRxiv - Microbiology 2020Quote: ... 5 µl of NEB3 buffer (New England Biolabs) and 10.75 µl of DNase-free water (Invitrogen ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 µl of 10X NEB2 buffer (NEB, US), and 35 µl of nuclease-free water ...
-
bioRxiv - Microbiology 2019Quote: ... 5 units T4 polynucleotide kinase (NEB cat. # M0201), 2.5 units Taq DNA polymerase (NEB cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... NEB 5-alpha F’Iq cells (New England Biolabs) were used as the recipient strain for all plasmid constructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL of CKII kinase (New England Biolabs) and 2.5 μL λ phosphatase (New England Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was treated with RNA 5’ Pyrophosphohydrolase (NEB) according to the manufacturer’s instructions prior to RNA circularization ...
-
bioRxiv - Molecular Biology 2019Quote: ... and containing 5 mM each NTPs (NEB # N0466S). After incubation for 3 hours at 37°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 nM M13mp18 ssDNA template strands (Bayou Biolabs) was mixed with 5-fold molar excess of DNA staple strands (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2021Quote: ... and RNAs were 5’dephosporylation by quickCIP (NEB). Input (sRNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 U of Taq Polymerase (NEB, M0267) and incubating the samples at 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 5 units of LongAmp taq DNA polymerase (NEB) and 50 ng of DNA sample extracted from infected cells in a 50 μL final reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... 5 µL terminal transferase (TdT) (NEB, CN M0315L). The reaction was incubated at 37 °C for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... and 5’ end repair with T4 PNK (NEB). The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’ ...