Labshake search
Citations for New England Biolabs :
1401 - 1450 of 4966 citations for 6 Hydroxy 4 trifluoromethyl 2 3' bipyridine 5 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... we introduced a 6-bp mutation using the Q5 site-directed mutagenesis kit (New England Biolabs). The pUAST-attB constructs were inserted into either attP40 or attP86Fb (for Piezo constructs ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6-8 µg of Cas9-mSA plasmid was linearized by Not1-HF restriction enzyme (NEB #R3189S). The 8.8kb linearized fragment was cut out from a 1.5% agarose gel and DNA was extracted using QIAquick Gel Extraction Kit (Qiagen #28115) ...
-
bioRxiv - Microbiology 2020Quote: ... and performed 6–9 cycles of PCR with the NEBNext Ultra II Q5 Master Mix (NEB) using Illumina P7 and the Seq-Well P5-TSO hybrid primer (Gierahn et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... Polylinker libraries were amplified using primers BC_CRX_Nested_F and BC_CRX_R (Supplementary file 6) for 30 cycles (NEB Q5) at an annealing temperature of 67C and then purified with the Monarch PCR kit ...
-
bioRxiv - Systems Biology 2019Quote: ... Biotinylation was performed in a 90 µl reaction with 6 U of T4 ssRNA Ligase (NEB), 4 µl Biotinylated Cytidine (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... The extracted dsRNA was mixed with Gel Loading Dye Purple (6×) (New England Biolabs, cat. #B7024S) and separated by 10% polyacrylamide gel (25 mA at 4°C for 18 hours) ...
-
bioRxiv - Biochemistry 2022Quote: ... the refolded 6×His-tagged precursors were treated with enterokinase (New England Biolabs, Ipswich, MA, USA) to remove their N-terminal 6×His-tag according to our previous procedure [3,18] and purified by HPLC using an analytical C18 reverse-phase column (Zorbax 300SB-C18 ...
-
bioRxiv - Genomics 2024Quote: ... the cfDNA can be de-phosphorylated by adding 6 μl of Antarctic Phosphatase buffer 10x (NEB), 2 μl of Antarctic Phosphatase Enzyme (NEB) ...
-
bioRxiv - Biochemistry 2024Quote: ... reactions were performed with 6 μl of PURExpress in vitro protein synthesis system (New England Biolabs). The reactions were carried out on different templates (Supplementary Table 2) ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2020Quote: ... pCS2+MT-hoxb4a was linearized with NotI and transcribed with SP6 RNA polymerase in the presence of a G(5′)ppp(5′)G RNA cap structure analog (New England BioLabs Inc.). 25 pg of hoxb4a mRNA was injected into one-cell-stage embryos.
-
bioRxiv - Genomics 2019Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.4 mM phenylmethylsulfonyl fluoride (PMSF) and 4 µM pepstatin) and digested with the chosen endoglycosidase (PNGase F, New England Biolabs; or Endoglycosidase H, Roche) in a small volume of the appropriate buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 µg total RNA was incubated at 37°C for 30 min together with DNaseI (2 U, NEB). To inactivate the DNaseI ...
-
bioRxiv - Immunology 2021Quote: ... the samples were added to 2 μL of second-strand synthesis mix containing 2.25× NEB buffer 2 (NEB), 0.625mM each dNTP Mixture (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The purified products were subjected to dA tailing with 2 μL of 10X NEBuffer 2 (New England BioLabs), 0.1 μL of 100 mM dATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome protected RNA fragments were 3’ dephosphorylated with T4 polynucleotide kinase (NEB) in 150 mM MES-NaOH pH 5.5 ...
-
bioRxiv - Genomics 2021Quote: ... and 150 μg chromatin was immunoprecipitated using 3 μg H3K18la (PTM Biolabs) overnight at 4°C with gentle rotation (20 rpm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 3 μL DNase I (both New England Biolabs, Ipswich, MA, USA) was added to 30 μL of the mixture and incubated for 22 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 30 μg was diluted 1:3 in gel loading buffer (NEB), sonicated ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’ end dephosphorylation was performed with T4 polynucleotide kinase (New England Biolabs) before addition of a pre-adenylated linker using RNA ligase (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3.5 µL of 3 U/µL T4 DNA Polymerase (New England Biolabs) was added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: About 3 μg plasmid was digested with 20 units SapI (NEB, R0569) and dephosphorylated with 3 units rSAP (NEB ...
-
bioRxiv - Physiology 2022Quote: ... and 3 U of DNAse I (catalog no. M0303, New England BioLabs) were added per ml of mix ...
-
bioRxiv - Molecular Biology 2022Quote: ... The modified pcDNA3-3×-FLAG have been digested with EcoRI & NotI (NEB) and the pcDNA3-V5 vector has been digested with KpnI & BamHI ...
-
bioRxiv - Physiology 2019Quote: ... such that following digestion (3 units of BsrI (New England BioLabs, R0527) in NEB Buffer 3.1 (B7203) ...
-
bioRxiv - Genetics 2020Quote: ... 3’-end RNA dephosphorylation was performed on beads with PNK (NEB M0201L) for 20 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 µl Ultra II End-prep enzyme mix (New England Biolabs). Samples were incubated at 20°C for 5 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’ adaptor was ligated to the cDNA using T4 ligase (NEB; M0202S). The cDNA was purified using Dynabeads myOne SILANE (life Technologies ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ ends were dephosphorylated with T4 polynucleotide kinase (T4 PNK; NEB) in the following reaction mix ...
-
bioRxiv - Genomics 2022Quote: ... 3′ Adapter ligation was done using T4 RNA Ligase 1 (NEB, M0204L). A first binding to streptavidin beads (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... and 3 μL of Ultra-prep enzyme mix (New England Biolabs, UK), and completed with molecular biology grade water ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μl NEBNext Ultra II End Prep Enzyme Mix (NEB, E7546), incubated for 10 min at room temperature followed by 10 min at 65 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... these cells were treated with 3 µM SNAP-Cell TMR-Star (NEB) for 30 min at 37°C and washed in 10% FBS DMEM for 30 min ...
-
bioRxiv - Plant Biology 2024Quote: ... ble cassette and 1 kb 3’ homologous arm onto the BamHI (NEB) digested backbone of pUC57 ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 μM CaCl2) and digested with 1/100 MNase (New England Biolabs). After addition of 250 µL sonication buffer (90 mM Hepes pH 7.9 ...
-
bioRxiv - Microbiology 2023Quote: ... using Phusion High Fidelity polymerase with HF buffer and 3% DMSO (NEB) under the following cycling conditions ...
-
bioRxiv - Biophysics 2023Quote: ... The sample was treated with 3 U/μL of micrococcal nuclease (NEB) in 50 mM HEPES-KOH pH 7.4 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT) were treated with 3 ul (15 units) RNaseH1 (NEB) or H20 as a control and incubated at 37°C for 2 hr with slight agitation (300 rpm) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 µg were DNAsed with DNase I treatment (New England Biolabs). RNA was directly ribodepleted with the riboPOOL kit (siTOOLs ...
-
bioRxiv - Cell Biology 2024Quote: ... The 3′ cDNA adapter was ligated by T4 RNA ligase 1 (NEB) by incubating at 25 °C for 16h ...
-
bioRxiv - Bioengineering 2023Quote: ... catalog #70015-3) using T4 DNA ligase (New England Biolabs, catalog #M0202L). We then packaged ligation reactions using T7Select415-1b cloning kit (Novagen (EMD Millipore) ...
-
bioRxiv - Systems Biology 2024Quote: ... and 3 μL of NEBNext Ultra II End Prep Enzyme Mix (NEB) were added to each sample and mixed well by pipetting up and down ...