Labshake search
Citations for New England Biolabs :
1051 - 1100 of 4668 citations for 6 Hydroxy 4 trifluoromethyl 2 3' bipyridine 5 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... and 4 μl Klenow DNA polymerase (NEB M0210L) to the mixture ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μL Proteinase K (New England Biolabs P8107S) (final concentration of 0.2 mg/mL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), 2 µL of 2 mM dNTPs (Takara #4025) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), 2 µL of 2 mM dNTPs (Takara #4025) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of Phusion HF Buffer (NEB #B0518S), and 0.4 µL of 10 mM dNTPs (Takara #4030) ...
-
bioRxiv - Molecular Biology 2023Quote: Proteinase solution: 4 μL proteinase K (NEB, P8107S) was added into 1 mL 0.1 M Tris-HCl 0.05 M EDTA (pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... and 4 μL T4 PNK (New England BioLabs) in a 100 μL reaction for 2 hours at 37°C and purified using Micro-Bio P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3’ deoxy-adenine overhangs were added using Klenow Fragment (NEB), the sample was purified with QIAquick column ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl (3 U/μl) of T4 DNA polymerase (NEB), 1 μl (10 U/μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions contained 3 µL of BSA (New England Biosciences (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 μl AnP stock (5,000 units/ml, New England Biolabs) was added to 50 μM purified CST in Buffer A along with 0.5 mM ZnCl2 and 1mM MgCl2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... NEB Buffer 3 was replaced by T4 PNK buffer (NEB) in kinase assays in the presence or absence of Xrn1 (Figs 3a and 5d) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit) were added and incubated for 18 h at 16°C over-night ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.17 μL of random primers (3 mg/mL NEB) in a total volume of 5.25 μL ...
-
bioRxiv - Bioengineering 2019Quote: ... and 3’-A-tailed with NEBNext dA-Tailing Module (NEB) following the recommendations of the manufacturer ...
-
bioRxiv - Genomics 2020Quote: ... 3 mM DTT 8 μl Large Klenow Fragment (NEB, #M0210L) and 2 μl T4 PNK (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... gDNA (3 μg) was digested by HpaII (New England Biolabs) at 37°C for 1 hr ...
-
bioRxiv - Biochemistry 2021Quote: ... and 40 U of β1-3 Galactosidase (New England Biolabs) for 16 h at 37°C.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA (3 μg) was treated with DNase (New England Biolabs) and reverse transcribed using random primer mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µL Ultra II End-prep enzyme mix (NEB, E76468). The mixture was incubated at 20 °C for 5 minutes and 65 °C for 5 minutes ...
-
bioRxiv - Genetics 2023Quote: ... 1 μl T4 PNK (3′ phosphatase minus, New England BioLabs)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A-tailing by Klenow Fragment (3’è5’ exo-; NEB M0212S), and TruSeq 6-bp index adaptor ligation by Quick ligase (NEB M2200S) ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL NEBNext Ultra II End Prep Enzyme Mix (NEB), and nuclease-free water (NFW) ...
-
bioRxiv - Genomics 2023Quote: ... 3 uL of 10x T4 ligase buffer (New England Biolabs), 75 ng destination vector ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL containing 0.01 U Bst 2.0 DNA polymerases (NEB), 0.5 U SplintR ligase (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The 3 library pools were purified by an ExoSAPII (NEB) reaction to remove single-stranded DNA and further by column purification (MiniElute Gel Extraction Kit ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (3 μL APOBEC reaction buffer (NEB), 0.3 μL APOBEC (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µl Ultra II end prep enzyme mix (NEB), and incubated at 20 °C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA 3’ ends were dephosphorylated using T4 PNK (NEB, M0201). DNA ends were then blunted using T4 DNA polymerase (NEB ...
-
bioRxiv - Genomics 2024Quote: ... followed by 3′ adapter ligation using T4 RNA ligase (NEB). Biotinylated RNAs were enriched for a second time ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Genomics 2021Quote: ... exonuclease I (Exol) treatment was performed on all samples by adding 4 ul ExoI buffer and 4 ul ExoI (New England Biolabs, M0293L). Samples were incubated at 37 C for 30 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
bioRxiv - Genomics 2019Quote: ... 5 µL PNK (10 U/µL, NEB) was added ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Quick T4 Ligase (NEB) in 1X Quick Ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 U Antarctic phosphatase (New England BioLabs) and labeled internal standards were added ([15N2]-cadC 0.04301 pmol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 32mM S-Adenosyl methionine (NEB) (final concentration 0.8 mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... protein tyrosine phosphatase (PTP, 5 unit; NEB), or sodium orthovanadate (Na3VO4 ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 1 μl 5′ deadenylase (New England Biolabs) and 1 μl RNaseOUT ...
-
bioRxiv - Microbiology 2020Quote: ... 5 Us of exo(-) Klenow Fragment (NEB), 200 pmol of NNSR-2 Primer for 30 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 5 μl Large (Klenow) fragment (NEB) to the DNA at R.T ...