Labshake search
Citations for New England Biolabs :
1201 - 1250 of 1706 citations for Bis 3 acetyl 4 hydroxyphenyl methane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... the pulL gene was PCR-amplified from plasmid pCHAP8258 as template using primers PulL Kpn 5 and PulL Eco 3 with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products were purified on a Qiaquick spin column ...
-
bioRxiv - Cell Biology 2022Quote: ... The 3′ end of the fragmented RNA was dephosphorylated with T4 polynucleotide kinase (PNK, New England Biolabs, Ipswich, MA, USA) followed by heat-inactivation ...
-
bioRxiv - Molecular Biology 2024Quote: The golden gate assembly reaction was assembled in a PCR tube by mixing 100 ng of the vector with a 3 fold molar excess of the purified PCR product (calculated using the NEB bio calculator ...
-
bioRxiv - Bioengineering 2024Quote: ... anchored primer was used to create a complementary strand to the TdT extended products using 15 units of Klenow Fragment (3′→5′ exo-) (NEB) in 1× NEB2 ...
-
bioRxiv - Bioengineering 2024Quote: ... Illumina adapters were ligated on at the 3′ end of the complementary strand using 1× TA Ligase Master Mix (NEB). All products were indexed and sequenced on an Illumina MiSeq instrument ...
-
bioRxiv - Plant Biology 2023Quote: ... without its Stop codon and with a Gly-Gly-Ser-Gly-linker at the 3’-end was first amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the primers GGB_OEP7_F – AACAGGTCTCAAACAATGGGAAAAACTTCGGGAGC and GGC_OEP7_GGSG_R – AACAGGTCTCTAGCCTCCAGATCCTCCCAAACCCTCTTTGGATGTGG ...
-
bioRxiv - Biochemistry 2024Quote: ... and tRNAGln with 5 nt-long 5’ leader and same 24 nt-long 3’ trailer as tRNATyr (5–tRNAGln–24) – were transcribed in reactions containing 1x T7 RNA polymerase reaction buffer (NEB), 0.001% (w/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... and two BsmBI Type IIS restriction enzyme sites was cloned into the 3’ end of the bovine U6 promoter using Gibson Assembly (NEBuilder HiFi, NEB) (see Supplementary Figure 1a) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the double-stranded (ds) cDNA was PCR amplified with primers directed against 5’ and 3’ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes secondary PCR was performed using TrueSeq primers (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: Adult worms from INF418 (nonEx106[myo-2p::GCaMP8f::unc-54 3’UTR]) and INF96 (syIs391[myo-2p::NLS::GAL4SK::VP64::unc-54 3’UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-ACG CGT ACT AGT CGA TCG CTT GTA CAG CTC GTC CAT G-3’ (reverse primer) and using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: Each 900 ng of high molecular weight NA12878 DNA was preprocessed by first blocking at the 3’ ends with Klenow (exo-) (NEB) in the presence of 10 µM dideoxynucleotides and 1X NEBuffer 3.1 for 30m at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was diluted 1:10 and 3 µl of diluted cDNA was used as input for qPCR using Luna by NEB master mix for a 20 µL total reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... nascent RNA was isolated with streptavidin beads and barcoded adapters ligated at 3’ ends of the nascent RNA (T4 RNA ligase 1 enzyme, M0204L; NEB) overnight at 25° C ...
-
bioRxiv - Plant Biology 2023Quote: ... the RNAs were dephosphorylated and the L3 linker (Supplementary Data 1) ligated to the 3’ ends using RNA ligase (NEB). The RNA 5’ ends were radiolabeled using [γ-32P]-ATP and polynucleotide kinase and the covalently-linked protein-RNA complexes separated on a 4-12% NuPAGE Bis-Tris gel (Thermo Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Promoters and 3’ UTRs were amplified from Col-0 genomic DNA using the primers listed in (Supp Table 3) with Q5 Hot Start High-fidelity DNA polymerase (NEB). For MBD5 and SUVH3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Table S6 ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Genetics 2023Quote: ... and SWI4 3’UTR (1000 bases downstream of ORF) were cloned into a LEU2 single integration vector by Gibson assembly (NEB) (Gibson et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... reverse 5’-GTGGCC CTCGAG TCA GTG AGT TTC ATG TTG G-3’ and then purified using the Monarch PCR plus DNA purification kit (NEB). The purified PCR product was digested by KpnI and XhoI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Double stranded on-bead DNA was digested with a mix of 3 blunt cutting enzymes (SspI-HF, StuI, and HincII) (NEB) to generate blunt-end DNA ...
-
bioRxiv - Microbiology 2023Quote: Lysates of U2OS cells infected with wild-type HSV-2 186 at an MOI of 3 for 24 h were treated with calf intestinal alkaline phosphatase (CIP) (New England BioLabs) as described previously60.
-
bioRxiv - Molecular Biology 2023Quote: ... 5′ phosphorylated and 3’ A-tailed by NEBNext Ultra II End Prep Enzyme Mix following the manufacturer’s instruction (New England Biolabs #E7645L). An adaptor was ligated ...
-
bioRxiv - Genomics 2023Quote: ... The DNA with end tags was oxidized in 15 μL TET2 reaction mix (3 μL TET2 reaction buffer plus reconstituted TET2 reaction buffer supplement (NEB), 0.3 μL oxidation supplement (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... The error-prone PCR (with an error rate of 3- to 5-nucleotide mutations per kilobase) was carried out with the Taq DNA polymerase (New England BioLabs) in a reaction containing 2 µl of 10 mM primers ...
-
bioRxiv - Microbiology 2023Quote: ... A second DNA adapter (containing a random-mer of 10 (N10) random bases at the 5′ end) was then ligated to the cDNA fragment 3′ end (T4 RNA Ligase, NEB) in the presence of a high concentration of PEG8000 and dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Microbiology 2024Quote: The msdDNA cDNA was isolated from acrylamide gels and 100 ng was used to extend the 3’ end with dCTP or dGTP and terminal deoxynucleotidyl transferase (TdT) from NEB, according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB). The resulting fragments were ligated to Nextflex adapters (Bio Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... 5 µl of soluble lysate were incubated at 37 °C for 1 hour with 0.7 µM of a fluorescent ssDNA substrate (5′-ATT ATT ATT ATT CAA ATG GAT TTA TTT ATT TAT TTA TTT ATT T-fluorescein-3′) and 2.5 U of UDG (NEB #M0280) in a total reaction volume of 10 µl (diluted in reaction buffer) ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissue cultures that were cultivated on one filter membrane (3 cultures) were transferred as one sample into RNA Protection buffer (New England Biolabs) and RNA was isolated according to the manufacturer’s instructions (Monarch® Total RNA Miniprep Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... on-bead decapping and phosphorylation were performed in a 30 μl reaction with 5 units T4 PNK 3’ phosphatase minus (NEB), 2.25 μg GST-Dcp1-Edc1-Dcp2 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Cell Biology 2022Quote: ... pDRF1-GW eCFP was made by performing a PCR with KOD One™ PCR Master Mix on AKAR3-EV with FW primer 5′-ATGCTAGCATGGTGAGCAAGGGCG-3′ and RV primer 5′-TAGCGGCCGCTTACTTGTACAGCTCGTCCATGCCG −3′ after which the PCR product and pDRF1-GW were digested using NheI-HF and NotI-HF (New England Biolabs). Finally ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Immunology 2022Quote: ... Beads were washed and resuspended in NEBuffer 3 containing Calf Intestinal Alkaline Phosphatase at a concentration of 0.5 U/μl (NEB, M0290) to dephosphorylate the RNA ...
-
bioRxiv - Genetics 2022Quote: ... I23A was introduced at the same time with GFP knock-in by incorporating the corresponding mutation in the 3’ homology arm on the repair template plasmid using the Q5 site-directed mutagenesis kit (New England Biolabs). GermLine Optimized mScarlet-i sequence (Fielmich et al ...
-
bioRxiv - Genetics 2022Quote: ... 5 ’TTAGCTCTTAAAC NNN…NN NCCAACAAG 3’) and ligating them together with the linearized vector using the T4 DNA ligase enzyme (NEB). Cloning of sgRNAs in a multiguide expression system (SP199 ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Plant Biology 2022Quote: ... Four vectors including one of the active 5′gRNA-pairs and one of the active 3′gRNA-pairs were digested by BglI (New England Biolabs) and ligated at once ...
-
bioRxiv - Molecular Biology 2022Quote: ... The RNA was then end-repaired with 20 U of 3’-phosphatase-positive bacteriophage T4 polynucleotide kinase (T4 PNK; New England Biolabs), using conditions recommended by the supplier (1× PNK buffer without ATP ...
-
bioRxiv - Microbiology 2022Quote: ... then 3’-adenylated and NEXTflex HT Barcodes (Bio Scientific Corporation) were added using NEBNext DNA modules products (New England Biolabs). After two consecutive cleanups with 1×AMPure XP ...
-
bioRxiv - Pathology 2022Quote: ... A targeting vector with P2A-CreERT2-T2A-GFP-stop codon-rabbit beta globin polyA sequence flanked by 5’ and 3’ homology arms was generated using NEBuilder HiFi DNA Assembly (NEB) and cloned into a pKO2 backbone plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Beads were then dried before adding 50 µL DNaseI mix (3 U of DNaseI in 1X DNAse buffer (NEB, #M0303L) and incubated at 37 °C for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Supplementary Table 3 ...
-
bioRxiv - Systems Biology 2023Quote: Mutated or wild type sequences of RORC 3’UTR were cloned into the dual GFP-mCherry reporter using MluI-HF and PacI restriction enzymes (NEB) as described above ...
-
bioRxiv - Genomics 2022Quote: ... pJR98 was digested by AscI and ssDNA oligo donors of the sequence 5’ CTCTTCCTGCCCGACCTTGGGG – reverse complement IBC – CAGCGCCATAGCTGAGTGTAGATTCGAGC – 3’ were cloned into the vector using NEBuilder HiFI DNA Assembly Master Mix (NEB). Third ...