Labshake search
Citations for New England Biolabs :
1151 - 1200 of 1706 citations for Bis 3 acetyl 4 hydroxyphenyl methane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... The LPHN-1 and -3 genes were amplified by PCR and digested by T7 endonuclease using the EnGen Mutation Detection Kit (New England Biolabs) according to directions in combination with the custom primers that flank the appropriate CRISPR-targeting regions (Fig ...
-
bioRxiv - Biochemistry 2021Quote: ... purified RNA was dissolved in 3 μl RNase H reaction mix (1x RNase H buffer [NEB], 40 pmol oligo(dT)12 ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... The insert possessing the additional A at 3’ end was ligated to the linearized vector with additional deoxythymidine (T) residues using T4 DNAligase (NEB). The plf gene cluster from strain QT598 (plfQT598 ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Microbiology 2020Quote: ... A Ty tag DNA sequence was inserted at the 3’-end of the gat1 coding sequence using a Q5 site directed mutagenesis kit (NEB) and Fn and Rn primers ...
-
bioRxiv - Genetics 2021Quote: ... yoaALexAp1 5’-GCGCCCTCAT CCTGACATAA TGTCCCTTCA AATCAAGGGA CGGTAGTGTG ACGGAC-3’ and yoaALexAp2 5’-GTCCGTCACA CTACCGTCCC TTGATTTGAA GGGACATTAT GTCAGGATGA GGGCGC-3’ and amplification with the Phusion High-Fidelity DNA Polymerase PCR kit (New England BioLabs). Constructs were sequence verified.
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding the HALO sequence was fused to that encoding the 3’-terminus of CFF1 using Gibson Assembly (New England Biolabs) (75) ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was digested with Not1 and EcoR1 to accept two overlapping PCR fragments and a 1Kb 3’Arm by Gibson assembly (NEB). Aplnr (NM 011784.3 ...
-
bioRxiv - Immunology 2021Quote: Antisense DNA probes (Table S7) were synthesized at Metabion AG and 3’ mono-biotinylated using terminal transferse (New England Biolabs) and Biotin-11-ddUTP (Jena Bioscience ...
-
bioRxiv - Genetics 2020Quote: ... and T3 (5’-AATTAACCCTCACTAAAGGG-3’) promoter-tagged PCR fragment from each gene using corresponding T7 and T3 RNA polymerase (T3:M0378S; T7:M0251S, BioLabs). Primers used for PCR are listed in Supplemental table 1 ...
-
bioRxiv - Biophysics 2020Quote: ... backbone and insert were mixed at a 1 to 3 ratio (40 fmol in total) in CutSmart® Buffer (NEB) supplemented with 3mM ATP and 10mM DTT ...
-
bioRxiv - Cell Biology 2020Quote: ... pCS2-luciferase CDS or pCS2-luciferase with G3BP1 5’UTR and 3’UTR were linearized with Sal I (New England Biolabs) and gel purified (Qiagen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3 µL of the assembly product was used to transform 65 µL of T7 Express chemically competent cells (NEB #C2566I) according to the manufacturer’s high-efficiency transformation protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... Deletions within the nhr-23 3′ UTR reporter (cloned in pHR017) were created using a Q5 Site-Directed Mutagenesis Kit (NEB) and verified by Sanger Sequencing (Genewiz Inc.) ...
-
bioRxiv - Microbiology 2023Quote: ... an ‘A’ base was added to the 3’ end of the blunt-end phosphorylated DNA fragments using the polymerase activity of Klenow (Exo-Minus) polymerase (NEB); Illumina genomic adapters were ligated to the A-tailed DNA fragments ...
-
bioRxiv - Microbiology 2023Quote: ... The library preparation including an enrichment step for 5’-triphosphorylated RNAs by capping the RNAs with 3’-desthiobiotin-TEG-GTP (NEB) [15] and subsequent deep sequencing on a Illumina NextSeq 500 system with 75 bp read length were conducted at Vertis Biotechnologie (Germany ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... Endo H digestion was performed at 37°C for 1h in the presence of 1X GlycoBuffer 3 and 1 µL of Endo H enzyme (NEB). The lysates were boiled and subjected to SDS-PAGE and western transfer ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-TGGCCAGACGGAATCCAATG-3’ and 5’-GTGGTGGGCCACCAAGACGG-3’, and cloned into pX330-P2A-EGFP/RFP (Zhang et al, 2017) through ligation using T4 ligase (New England Biolabs). Nup96-GFP KI U2OS cells were transfected using X-tremeGENETM 9 DNA Transfection Reagent (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... The 5’ end ligated samples were purified using PCI extraction and then the 3’ App-PE adapters were ligated to the RPF using 40 U T4 RNA ligase I (NEB). The 5’ and 3’ ligated samples were resolved on a 12% TBE-Urea polyacrylamide gel and the band corresponding to the RPF was gel-excised ...
-
bioRxiv - Cell Biology 2023Quote: ... and inserted between Gly118- and Glu119-encoding codons of odr-3 (72) in the modified pMC10 vector using NEBuilder HiFi DNA assembly (NEB). The resulting plasmid sequence was confirmed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... and primers listed in (Extended Data Table 3) and used for in vitro transcription by T7 RNA polymerase (New England Biolabs). Resulting RNA was purified using a spin-column kit (RNeasy mini kit ...
-
bioRxiv - Biophysics 2023Quote: ... We combined the plasmid backbone with the colony PCR insert by mixing them in molar ration 1:3 in the 2xHiFi mix (New England Biolabs). We incubated the reaction at 50°C for 60 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloned under control of the hlh-3 promoter in pSL780 (Bone et al., 2016) with Gibson cloning (New England Biolabs) to generate pSL814 ...
-
bioRxiv - Biophysics 2023Quote: ... was used.23 The RNA was ligated to a 5ʹ-phosphorylated-Cy3-oligo at the 3’ end of the RNA by T4 RNA ligase (NEB) by following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µL of RNA from 4 x 96 well plates was transferred to a 384 well plate with 3 µL of master mix containing 1 µL of a 10 mM stock of dNTPs (NEB Catalog# N0447L ...
-
bioRxiv - Molecular Biology 2023Quote: ... Second-strand DNA synthesis was done by ligating 10 µM of a blunt-end duplex comprised of a 32-bp Illumina R1-3’SpC3 and 5’-phosphorylated R1R-3’SpC3 DNA (pre-annealed by incubating at 95°C for 3 min and slowly cooling to 25°C) using a Quick ligase kit (New England Biolabs) according to manufacturer’s protocol followed by clean-up as described above ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... The purified ribodepleted RNA samples were fragmented for 3 minutes at 94°C in Magnesium RNA Fragmentation Module (New England Biolabs) and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen) ...
-
bioRxiv - Immunology 2023Quote: ... were incorporated onto the mab-oligos via a 50 μl gap-fill ligation reaction consisting of 40 U Taq ligase (New England Biolabds) 3 U T4 DNA polymerase (New England Biolabs), 100 μM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed using specific reaction primer pairs specific to the appropriate parental segment (Table 3) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 µl of the purified assembly is incubated with 50 µl of NEB 10-β-competent E.coli cells (NEB, C3019H) for 30 min at 4 ℃ ...
-
bioRxiv - Cell Biology 2023Quote: ... Donor sequences were then inserted at the HindIII (5’) and XhoI or BamHI at (3’) sites using HindIII-HF and XhoI-HF or BamHI-HF (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... The 32P-radioabelled RNase III.RNA complexes were washed and unique barcoded 5’ linkers and 3’ App-PE adapters were ligated to the bounded RNA using 40 U T4 RNA ligase I (NEB) for each ligation step ...
-
bioRxiv - Microbiology 2023Quote: ... was synthetized by introducing a 984 bp fragment from the 3′ end of the GEXP15 ORF into pGDB between the XhoI/AvrII (New England Biolabs). PetDuet-1 was purchased from Novagen.
-
bioRxiv - Biochemistry 2023Quote: ... The oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... IVT RNA products (2×10-3 dilution) were tested for absence of carry-over plasmid template by PCR using Taq 2X master mix (NEB). A negative PCR result would confirm the absence of carryover plasmid in the IVT product.
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was treated with RNase H before second-strand synthesis by Klenow fragment (3′ to 5′ exonuclease) (New England Biolabs), then the double-stranded cDNA was sheared into average of 200 bps fragments using a Covaris focused ultrasonicator E210 ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2022Quote: ... were annealed to an oligonucleotide containing the antisense of the 3’ restriction site (5’-GGT TGA TTA TCG ATA AGC TT-3’) and extended using Klenow Polymerase devoid of exonuclease activity (NEB). Resulted fragments were inserted into the pAAV-CAG-hFXN plasmid between the stop codon of the hFXN and poly A signal ...
-
bioRxiv - Synthetic Biology 2022Quote: ... or PCR amplified using primers that anneal to the 5’ or 3’ ends of each chunk with Phusion polymerase (New England Biolabs). Plasmid digested or PCR amplified chunks were excised from agarose gels or column purified ...
-
bioRxiv - Plant Biology 2022Quote: ... The entry module pGG-B-AtU6-26-BRI1-2-C and pGG-A-AtU6-26-BRI1-3-B were generated by annealing oligos for each gRNA and ligating into BbsI-digested (New England Biolabs) Golden Gate entry vectors described in (66) ...
-
bioRxiv - Physiology 2022Quote: RNA-sequencing libraries were prepared by depleting eukaryotic ribosomal RNA with the NEBNext rRNA Depletion Kit prior to library synthesis with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and addition of multiplex oligos using the Unique Dual Index Primer Pairs Set 3 (NEB). Library quality control was performed using Qubit and Bioanalyzer 2100 ...