Labshake search
Citations for New England Biolabs :
1201 - 1250 of 1722 citations for 10 PROPOXY DECANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... along with a well containing 10 µl Quick-Load® Purple 1 kb DNA Ladder (New England Biolabs catalog no ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 10 μM of the dsAdR adaptor along with 1 μl (400 U) T4 DNA Ligase (New England Biolabs) were added in each ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with 10–14 cycles of enrichment for each sample and using Phusion High-Fidelity Master Mix (NEB catalog #M0531). Samples were submitted for 101 bp paired-end sequencing on an Illumina HiSeq2000 at BGI-Hong Kong ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 ng for CTCF and 10 ng for input) were processed using NEBNext ChIP-seq library (New England Biolabs) with manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1µg purified RNA was incubated at 37°C for 30 min with 10 units of T4 PNK (NEB, M0201S) in PNK buffer containing 20 units SUPERase•In in a 25 µl reaction to remove 2′-3′-cyclic phosphates of reporter RNAs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Genomics 2020Quote: ... were combined with RT primer mix [1 μl 250 ng/μl randomhexRT primer and 0.5 μl 10 mM dNTPs (NEB)] ...
-
bioRxiv - Genomics 2020Quote: ... 300 ng of purified genomic DNA was nicked with 10 U of nicking endonuclease Nt.BspQI [New England BioLabs (NEB)] at 37° for 2 hr in buffers BNG3 or BNG2 ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... Reverse transcription was carried out using 10 ng of purified RNA in a reaction with ProtoScript II (NEB M0368S) using 2.0 pmol NI-1032 as a gene-specific primer (Table S1) ...
-
bioRxiv - Genomics 2020Quote: ... 0.5 μL of Ultra II Ligation Module Enhancer and 10 μL of Ultra II Ligation Module master mix (NEB) made up of a total of 20 μL with NFW ...
-
bioRxiv - Microbiology 2020Quote: ... IVT gRNA was produced from SFV infectious clone plasmid and treated with 10 U of DNase1 (RNase-Free; NEB) for 30 min at 37°C before purification with the RNeasy MiniElute Cleanup kit (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... 1 pmol of DNA template was mixed with 10 pmol of oligonucleotide 9 labeled with Yakima Yellow and 1µL of HemoKlen Taq DNA Polymerase (New England Biolabs) in a 6µL reaction mixture containing 50 mM Tris-HCl pH 9.0 ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were lysed in 100 µl lysis buffer (5 ml contain: 10 mM Tris-HCl pH 7.5, 4% SDS, 1 PhosSTOP tablet [Roche], a scoop of DNase I [NEB]) for 5 min at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then permeabilized in ice cold extraction buffer (CSK, 0.1% TX-100 and 10 mM Ribonucleoside Vanadyl Complex (NEB)) for 5 minutes ...
-
bioRxiv - Genomics 2020Quote: Cas9 protein and transcribed sgRNA were incubated for 10 min at room temperature in reaction buffer containing 1× NEB buffer 3.1 (NEB Biolabs) supplemented with 1 mM DTT ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was done in bacterial strain Escherichia coli NEB® 10-beta (New England Biolabs, Frankfurt a. M., Germany) grown at 37 °C in lysogeny broth [47] supplemented with 60 mg L-1 ampicillin (Applichem ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Purified first-round PCR products were combined with 10 μl NEBNext 2x High-Fidelity Master Mix (New England Biolabs), and 0.3 μM of each barcoding primer containing adapters and indexes to a total volume of 20 μl ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We performed a 10-cycle PCR using a Phusion PCR Kit according to the manufacturer’s protocol (New England Biolabs) with multiplexed primers and adjusted PCR products to 10 μM for sequencing on either an Illumina HiSeq2500 (125 bp paired-end ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were then resupended in 100 µL Ligase Solution (50mM HEPES pH 7.5, 10 mM MgCl2, 1mM rATP (New England Biolabs), 9.5 nM Connector oligomer (TTTCACGACACGACACGATTTAGGTC ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ end of the digested RNA is then labelled with 10 U T4 PNK (New England Biolabs M0201) and 10 µCi [γ-32P]ATP (Perkin Elmer BLU002Z250UC ...
-
bioRxiv - Cell Biology 2021Quote: ... The Pre-hybridization Buffer was replaced with 250 μl of Hybridization Buffer (2x SSC, 10% deionized formamide, 0.1% Tween-20, 2 mM vanadyl ribonucleoside complex (New England Biolabs), 100 μg/mL salmon sperm DNA (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 96-well plates were centrifuged again at 3000 x g for 10 min and 1 µL of the supernatant was used in 12.5 µL PCR reactions with Taq polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant was passed three times over a column of 10 ml of amylose resin (New England Biolabs, E8031L). The column was washed with MBP wash buffer (50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in 18.5 μL T4 DNA Ligase Reaction Buffer with 5 μL of 10 μM annealed Broken end linker and 1.5 μL T4 DNA Ligase (#M0202S, New England Biolabs). The reaction was incubated 18-20 h at 16°C with constant mixing ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded denatured (70 °C, 10 minutes) samples alongside an RNA ladder (2-4 μL, ssRNA ladder, N0362S, NEB). The resulting gels were stained with ethidium bromide for 30 minutes (0.5 μg/mL ddH20 ...
-
bioRxiv - Genomics 2021Quote: ... 10°C hold in one cycle) by adding 25 µl of 2X PCR master mix (New England Biolabs, M0541S) and 0.8 µl of Ad 2.X reverse primer ...
-
bioRxiv - Neuroscience 2022Quote: ... we added 1μL unique barcoded N5&N7 (0.5 µM final concentration) and 10 μL NEBNext High-Fidelity 2x PCR Master Mix (NEB). PCR cycling conditions were as follow ...
-
bioRxiv - Biochemistry 2022Quote: ... 1× CutSmart buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate,100 μg/mL BSA, pH 7.9, NEB), 20 U RiboLock ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng DNA was used to prepare sequencing libraries with the Ultra II DNA Library Prep kit (NEB #E7645S).
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was cut into pieces and PK buffer (100 mM Tris pH 7.4, 50 mM NaCl, 10 mM EDTA) was added together with Proteinase K (NEB). After 90 min of incubation at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... synthetic dsDNA target oligos were prepared by hybridizing 10 μM of ssDNA template with 50 μM of complementary ssDNA in 1x NEBuffer 2.1 (NEB), to provide a solution with an effective dsDNA concentration of 10 μM ...
-
bioRxiv - Developmental Biology 2022Quote: ... dissected wing imaginal discs were incubated for 10 min at 25°C with SNAP-Surface Alexa Fluor 546 (3.3 μM, from NEB), rinsed and incubated for 15 min with SNAP-Surface Block at 13 μM before fixation and immunolabeling ...
-
bioRxiv - Genomics 2021Quote: ... We amplified libraries by adding 10 ul DNA to 25 ul NEBNext HiFi 2x PCR mix (New England Biolabs) and 2.5 ul of a 25 uM solution of each of the Ad1 and Ad2 primers ...
-
bioRxiv - Evolutionary Biology 2021Quote: DNA was isolated from single fins by placing them in lysis buffer (10mM Tris pH 8, 100mM NaCl, 10 mM EDTA, 0.5% SDS) with Proteinase K (333µg/mL, NEB P8107S) at 55°C for between four hours and overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNase treatment of indicated samples was carried out by incubation of each sample with 10 μl of DNaseI (NEB), 5 μl of Benzonase Nuclease (Novagen ...
-
bioRxiv - Genetics 2020Quote: ... 10 μl of 20 ng/ul DNA per individual was fragmented using the high-fidelity enzymes NsiI / MspI (NEB) combined in a double digest ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μL of 10 μM FISH probes in hybridization buffer (10% dextran sulfate [Sigma], 2mM vanadyl ribonucleoside complexes [#514025, NEB], 0.02% RNAse-free BSA [NEB] ...
-
bioRxiv - Microbiology 2022Quote: ... Reverse transcription of 10 µl RNA was performed using LunaScript RT Supermix Kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The total volume reaction was 25 μl with the following composition: 5 μL 10× buffer at 1.0 mM (New England BioLabs), 0.1 mM each dNTP ...
-
bioRxiv - Biochemistry 2022Quote: ... The N-linked glycans and the CBP tag were cleaved by endoglycosidase H (Endo H, ∼0.2 mg per 10–15 mg purified protein, New England Biolabs) and HRV-3C protease (∼2 mg per 10–15 mg purified proteins ...
-
bioRxiv - Genetics 2019Quote: ... 10 pmoles of forward and universal reverse primers were annealed and extended with Q5 high-fidelity DNA polymerase (NEB) according to the recommended conditions and with the following program ...
-
bioRxiv - Biochemistry 2020Quote: ... 150 mM NaCl) and incubated for 10 min at 37 °C with 2.000 units/mL of DNase I (New England BioLabs). Half of the resulting sample was incubated with 10 µg/mL of PK (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by 10 µl of 10X NEB2 buffer and 15 µl of HindIII (New England Biolabs, 20 U/µl) to digest at 37°C for 2 hr ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The solution was then equilibrated to 42°C for 10 min before adding 2 μL of β-agarase (NEB). Finally ...
-
bioRxiv - Pathology 2019Quote: ... by adding a mixture of 10 µl DNase I and 190 µl DNase I Reaction Buffer (New England Biolabs) to the priming port and incubated for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the IVT template RNA (0.01– 0.05 A260 units) was digested into nucleosides using 10 µg/ml nuclease P1 (New England Biolabs, M0660S), and 0.5 U/ml Bacterial Alkaline phosphatase (Takara 2120A ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in 88 μL of NEBuffer 2.1 with 10 μL dNTP (1mM, #N0446S, New England Biolabs) and 2 μL T4 DNA Polymerase (#M0203S ...
-
bioRxiv - Bioengineering 2021Quote: ... 50 ng input genomic DNA was first linearly pre-amplified with 10 nM final concentration 5p-CCR5_UMI primer using the Q5 High-Fidelity DNA Polymerase (New England Biolabs): (98 °C ...