Labshake search
Citations for New England Biolabs :
1151 - 1200 of 5902 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: For a typical blunting reaction 5-50 ng of cfDNA are mixed with 5 μl of CutSmart 10x (NEB), 5 μl of dNTPs 1mM each ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 µL of the CspCI digest was mixed with 5 µL of NEBuilder HiFi DNA Assembly Master Mix (NEB), incubated at 50 °C for 15 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and 5 mM MgCl2) followed by a phosphorylation step of the 5’-terminal ends by the T4 PNK (NEB). This dsDNA duplex was ligated into the large plasmid digested with KpnI (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 uL of Taq polymerase (New England BioLabs, Ipswich, MA, USA), 1 uM of 50 mM MnCl2 ...
-
bioRxiv - Cell Biology 2020Quote: H4-SNAP histones were labelled with 3 μM TMR fluorophore (NEB) for 30 min in complete medium ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 μL of 20 mg/mL Proteinase K (NEB EO0491) was added to each sample ...
-
bioRxiv - Microbiology 2020Quote: ... and 3’-end dephosphorylated by 10 U T4-PNK (M0201S, NEB) in the presence of 20 U RNase inhibitor (M0314L ...
-
bioRxiv - Microbiology 2020Quote: ... For 3’ adaptor ligation the NEBNext Small RNA Kit (E7560S, NEB) was used ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 μl (0.5 μl per sample volume) of RNase If (NEB) was added and the sample was incubated at 37 °C for 15 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... mixed with 3 µL 10% SDS and 1.8U Proteinase K (NEB), and incubated for 1 hour at 50°C ...
-
bioRxiv - Molecular Biology 2022Quote: 3’-end 32P-labelled gapped DNA was generated using TdT (NEB) and [α-32P]dATP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 μl of USER enzyme (New England Biolabs; cat. no. M5505) were mixed with 16 μl of adapter-ligated DNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 2.5 μl of T4 DNA polymerase (3 U/μl NEB M0203), 2.5 μl of T4 PNK (10 U/μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.5 μl T4 DNA Polymerase (NEB, cat#M0203S, 3 U/μl) and 0.1 μl Taq DNA Polymerase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL NEBNext End Prep Enzyme mix (New England Biolabs, USA), 2.5 µg fragmented DNA and adjusted to 50 µL with nuclease free water (Qiagen ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... ligated to a 3’ adaptor using T4 RNA Ligase I (NEB), and purified using SDS-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Genomics 2021Quote: ... mixed with 3 μL 10% SDS and 1.8U Proteinase K (NEB), and incubated for 1 hour at 50°C ...
-
bioRxiv - Biophysics 2020Quote: ... GRN-3 was expressed in SHuffle™ cells (New England Biolabs), while GRN-5 was expressed in Origami 2 DE3 (Invitrogen ...
-
bioRxiv - Biophysics 2020Quote: ... mixed with 3 μL 4x LDS loading dye (New England Biolabs) and loaded onto 4-12% NuPAGE Bis-Tris gels (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... in NEB next Quick ligation buffer (3 μl, New England Biolabs) in the presence of 1 μl RNA CS (Oxford Nanopore Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and ligated species specific 3’ UTR with T4 DNA ligase (NEB). Each of the full length chimeric nos rescue fragments were cloned into pattB vectors using NotI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... digests were eluted in 1X NEBuffer #3 (B7003S, New England Biolabs) and undigested gDNA was eluted in TE ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3′-A overhang was added with Klenow fragment (NEB; M0212) and dATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Genomics 2023Quote: ... 25 pmol of SSAs were folded in 1x NEBuffer 3 (NEB) by heating at 95°C for 5 min followed by slow cooling to 25°C ...
-
bioRxiv - Genomics 2023Quote: ... was digested for 3 hours with PvuII-HF (NEB cat #R3151S) or PstI (NEB cat #R0140T ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fragmented RNA was 3’-end repaired using T4 PNK (NEB) and ligated to RNA adapter (5’-/5rApp/AGATCGGAAGAGCGTCGTG/3SpC3/-3’ ...
-
bioRxiv - Genetics 2024Quote: ... and 3 units of Taq DNA Polymerase (New England Biolabs, Inc.) under the following reaction conditions ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Genetics 2022Quote: ... and a 3’ loxP site in a HiFi Assembly reaction (NEB) with pBS-ISceI to give pBSIce-gata2aKI (Supplementary File 1).To construct a foxc1a targeting vector ...
-
bioRxiv - Microbiology 2022Quote: ... followed by 3′ adaptor ligation using T4 ligase (New England Biolabs). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... All samples were mixed with 3 μl Proteinase K (NEB P8107S) and incubated for 1 hour at 50°C ...
-
bioRxiv - Microbiology 2022Quote: ... The 3’ adenine (A) overhangs were then added by Taq (NEB) PCR and cloned into the TOPO-TA plasmid (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... 3 mM CaCl2) and was subjected to mild MNase (NEB, M0247S) treatment (20 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purified PCR products were 3′A-tailed using Taq polymerase (NEB) and cloned into TOPO TA-cloning vector (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: NEBNext 3’ SR adaptors for Illumina (New England Biolabs, cat# E7332) were ligated to the 3’ ends of total RNA from EVs and cellular samples isolated from an RN cell line using a truncated KQ T4 RNA ligase 2 (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: ... at 37°C for 3 hours in 1x CutSmart buffer (NEB). The digested plasmid was then visualised by agarose gel electrophoresis and the digested plasmid purified using the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: H in the reaction buffer containing GlycoBuffer 3 (B1720S, NE BioLabs) for 1 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA oligonucleotides were labeled in 3’ using poly(U) polymerase (NEB) and [α-32P]UTP ...
-
bioRxiv - Cancer Biology 2024Quote: ... We prepared α2-3 neuraminidase (P0728L, New England Biolabs, Ipswich, MA) at 250 U/mL in GlycoBuffer1 (50 mM sodium acetate ...
-
bioRxiv - Microbiology 2020Quote: ... followed by the addition of 5 μl of UDG reaction solution (New England Biolabs, 0.02 U μl−1 UDG in 1X UDG buffer) and an additional 30 min incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was slowly cooled down to room temperature with a Δ -1°C / second gradient and 0.5 μl of each RNase H (NEB, 5 U/μl), RNase T1 (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... The single stranded cDNA was ligated with a partial Illumina 5’ adaptor (HZG885:/5phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTddC) using T4 RNA ligase 1 (New England Biolabs, Ipswich, MA, US) and incubated overnight at 22 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped by incubating at 65°C for 5 min followed by addition of 5 mM MgCl2 and 0.5 units of Shrimp Alkaline Phosphatase (rSAP, NEB M0371S). The phosphatase reaction was incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... RJ-167-mer and RJ-5’Tail-167mer were radiolabeled with 32P at the 5′-end using T4 Polynucleotide Kinase (NEB). To generate the 3′ Tail and dsDNA DNA substrates ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... forward and reverse primer for GFP (forward 5’TCGACAGTCAGCCGCATCT3’ and reverse primer 5’CCGTTGACTCCGACCTTCA3’) respectively using 1μl taq polymerase (NEB, USA). The PCR amplification was performed as per the following cycle ...