Labshake search
Citations for New England Biolabs :
1251 - 1300 of 5902 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were incubated with: 5 units RNaseH1 (NEB) in RNaseH1 Buffer (50 mM Tris-HCl pH 8.3 ...
-
bioRxiv - Genomics 2023Quote: ... 5 µl of T4 DNA ligase (NEB, #M0202L), and 4 µl of 200 ng/µl linker were added to the 260 μ l of digested chromatin and mixed thoroughly ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 U of Antarctic phosphatase (NEB M0289S) then incubated at 37 °C for 2 hours ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μl of quick ligase (NEB M2200L). To release the non-ligated strand of the adaptor ...
-
bioRxiv - Microbiology 2023Quote: ... coli strain NEB 5-alpha (New England Biolabs) (Table S5).
-
bioRxiv - Genomics 2023Quote: ... 0.32 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.16 μL Q5 (NEB M0491S) ...
-
bioRxiv - Genomics 2023Quote: ... 0.7 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.35 μL Q5 (NEB M0491S) ...
-
bioRxiv - Physiology 2024Quote: ... 5 μL of PNGaseF (500 U/μL, NEB) with 1x GlycoBuffer 2 (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: RNase H 5 U/µL (NEB, Cat#M0297S)
-
bioRxiv - Developmental Biology 2024Quote: ... and NEB 5-alpha Competent E.coli (NEB C2987H) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... or 5 µL of O-Glycosidase (P0733L, NEB) where indicated prior to denaturation/loading on SDS-PAGE gels according to manufacturer protocols ...
-
bioRxiv - Plant Biology 2024Quote: ... and 5′ phosphorylated with T4 Polynucleotide Kinase (NEB). The fragments were mixed with Golden Gate cloning adaptors (5′ adapter ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 U/μl exonuclease III (NEB M0206L) and incubating for 15 min at 37°C with agitation (800 rpm 10 s ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli NEB 5-alpha cells (New England Biolabs). Part plasmids and the pET21b(+ ...
-
bioRxiv - Genomics 2024Quote: ... 40 U Antarctic Phosphatase (5 U/µL, NEB), 100 pg [15N5]8oxodG (Cambridge Isotope Laboratories ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5 units/μl T3 RNA polymerase (NEB, M0378S) and 1 x RNAPol reaction buffer (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 5 µL TAQ Ligase (NEB, 40 U/µL) and 0.5 µL BST DNA Polymerase FL (NEB ...
-
bioRxiv - Genomics 2024Quote: ... including 5-methyl-dCTP (NEB, Catalog no. N0356S), 5-Carboxy-dCTP (TriLink ...
-
bioRxiv - Biophysics 2024Quote: ... and further nicked with 5 units Nb.BbvCI (NEB) at 37 °C for 1 hour ...
-
bioRxiv - Biophysics 2024Quote: ... together with 5 units DNA Pol I (NEB). The mix was incubated for 1 hour at ∼22 °C and cleaned using magnetic beads ...
-
bioRxiv - Biophysics 2024Quote: ... T5 exonuclease (5 units/μg DNA, NEB, M0363) was added to the mixture and incubated at 37 °C for 30 min to digest the remaining nicked DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... coli poly(A) polymerase (5 U/μL) (NEB), with incubation at 37°C for 2 minutes ...
-
bioRxiv - Genetics 2024Quote: ... coli (NEB® 5-alpha Competent E. coli), and successful genetic manipulation was confirmed with sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... purified KRAS protein was mixed with GMP-PNP (molar ratio of 10:1 GMP-PNP:KRAS) and calf intestinal alkaline phosphatase (NEB cat# M0290, 3 units per mg of KRAS). The reaction mixture was incubated for 3 hours at room temperature and then purified by size-exclusion chromatography on a 10/300 Superdex 75 GL column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2024Quote: ... After addition of 200 µl nuclease elution mix (NEB nuclease P1 buffer 1 x, MgCl2 5 mM, 0.5 µl NEB nuclease P1, 0.5 µg benzonase) samples were incubated over night at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2020Quote: ... pCS2+MT-hoxb4a was linearized with NotI and transcribed with SP6 RNA polymerase in the presence of a G(5′)ppp(5′)G RNA cap structure analog (New England BioLabs Inc.). 25 pg of hoxb4a mRNA was injected into one-cell-stage embryos.
-
bioRxiv - Systems Biology 2021Quote: ... PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6) for 5 cycles at an annealing temperature of 66C followed by 5 cycles with no annealing step (NEB Q5) and then purified with the Monarch PCR kit.
-
bioRxiv - Systems Biology 2021Quote: ... P1 indexing barcodes were added using forward primers P1_inner_A through P1_inner_D and reverse primer P1_inner_nested_rev (Supplementary file 6) for 5 cycles at an annealing temperature of 55C followed by 5 cycles with no annealing step (NEB Q5). PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6 ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... and dominant negative RabD2T91N (RabD2TN) primers (forward primer 5’TGTTGGTAAAAACTGTTGTATGAATAGATATGTTAG3’ reverse primer 5’GAAGACTCTCCTACCATAATAAC3’) using Q5 Site-directed mutagenesis kit (E0554S New England Biolabs, USA) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome protected RNA fragments were 3’ dephosphorylated with T4 polynucleotide kinase (NEB) in 150 mM MES-NaOH pH 5.5 ...
-
bioRxiv - Genomics 2021Quote: ... and 150 μg chromatin was immunoprecipitated using 3 μg H3K18la (PTM Biolabs) overnight at 4°C with gentle rotation (20 rpm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 3 μL DNase I (both New England Biolabs, Ipswich, MA, USA) was added to 30 μL of the mixture and incubated for 22 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’ end dephosphorylation was performed with T4 polynucleotide kinase (New England Biolabs) before addition of a pre-adenylated linker using RNA ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3.5 µL of 3 U/µL T4 DNA Polymerase (New England Biolabs) was added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: About 3 μg plasmid was digested with 20 units SapI (NEB, R0569) and dephosphorylated with 3 units rSAP (NEB ...
-
bioRxiv - Physiology 2022Quote: ... and 3 U of DNAse I (catalog no. M0303, New England BioLabs) were added per ml of mix ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... The modified pcDNA3-3×-FLAG have been digested with EcoRI & NotI (NEB) and the pcDNA3-V5 vector has been digested with KpnI & BamHI ...
-
bioRxiv - Genetics 2020Quote: ... 3’-end RNA dephosphorylation was performed on beads with PNK (NEB M0201L) for 20 min at 37°C ...