Labshake search
Citations for New England Biolabs :
1001 - 1050 of 5902 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... 5 units of Antarctic Phosphatase (NEB) and 10 mU/µL of phosphodiesterase I (PDEI ...
-
bioRxiv - Immunology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart 10x (NEB), 2 μl of BSA (NEB) ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units of antarctic phosphatase (NEB), and 1 mM manganese chloride ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BsaI-HFv2 (NEB, R3733L), 250 U T4-ligase and nuclease-free water for a total of 5 µl reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... and Adenosine 5’-Triphosphate (ATP) (NEB). After RNA recovery using an RNA MinElute Cleanup Kit (QIAGEN) ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL High GC Enhancer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL High GC Enhancer (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... 5 uL 5X Phusion Buffer (NEB), 10 uL 1M Trehalose (Life Sciences Advanced Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... 5 µL of GC Enhancer (NEB), 5 µL of 5X buffer ...
-
bioRxiv - Genomics 2023Quote: ... or 5 U MboI (NEB R0147S) in 15 μl rCS buffer for 1 h at 37°C and analysed in a 1.2% agarose gel containing ethidium bromide ...
-
bioRxiv - Microbiology 2024Quote: ... coli NEB-5-alpha (NEB C2987) was used for plasmid cloning ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μM Mth RNA ligase (NEB), 1 x adenylation buffer (NEB) ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units DNA Pol I (NEB) with water in a total volume of 2x 20 μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... NEB 5-alpha competent E.coli (NEB) were transformed by ligated productions using manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: 5-alpha competent cells (NEB C2987H)
-
bioRxiv - Biophysics 2024Quote: ... NEB 5-ɑ (New England Biolabs) and BL21 (DE3 ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl 10x rCutSmart buffer (NEB) in a total volume of 50 μl and incubated for 15 min at 65 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... or NEB 5-alpha HE (NEB) E ...
-
bioRxiv - Genetics 2024Quote: ... 5 μl proteinase K (NEB, P8107) was added and the sample was mixed by pipetting ...
-
bioRxiv - Synthetic Biology 2024Quote: ... An additional reaction was conducted where 10 µg was digested using 3 µl of EcoRI-HF and 3 µl of mung bean nuclease (New England Biolabs, catalog number: M0250) at 37 °C for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Genomics 2024Quote: ... the 5’-end of nascent RNAs was decapped on-beads in RNA 5’ Pyrophosphorylase mix (NEB, M0356S) at 37 °C for 45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: G(5’)ppp(5’)A RNA Cap Structure Analog (New England Biolabs Japan Inc., Tokyo, Japan, #S1406)
-
bioRxiv - Microbiology 2024Quote: ... the RNA was ligated to the 5′-universal RNA adapter (5′GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA3′) using T4 RNA ligase (NEB). After extraction with 25:24:1 phenol/chloroform/isoamyl alcohol and ethanol precipitation ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Adaptor ligated RNAs 48-58nt long (corresponding to 19-29nt long input RNAs) were extracted and ligated to the 5’ adaptor using T4 RNA Ligase 1 (NEB, M0204). A total of ten variable nucleotides (unique molecular identifiers ...
-
bioRxiv - Genomics 2021Quote: ... 0.5 µg of the treated RNA was used for ligation to an RNA oligonucleotide with T4 RNA ligase 1 (NEB M0204) for 1 hr at 25 °C then converted to first strand cDNA with random priming and the ProtoScript II reverse transcriptase mix (NEB E6560) ...
-
bioRxiv - Systems Biology 2020Quote: ... 10 mM DTT, 12% PEG 8000, 1 mM each dNTPs, 10 µM dN-SMRT oligo, 5 µl Klenow enzyme NEB #M0212) for 1 h at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... Biotin-labeled DNA fragments captured on beads were ligated to multiplexing adaptors by adding 5 μL each adapter (50 μM) and 1 μL T7 DNA ligase (NEB, M0318L) in 100 μL ligation mixture and incubating at room temperature for 1 hour with rotation ...
-
bioRxiv - Biochemistry 2021Quote: ... at 37 °C for 1 hour or first with 5 units T4 Polynucleotide Kinase with 25 mM ATP in 1 X T4 Kinase buffer (T4PNK, NEB, M0236S) at 37 °C for 30 min and then with XRN-1 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’ ends of RNA fragments were phosphorylated by T4 PNK and ligated to 5’ adaptor (CGATCTCCAATTCCCACTCCTTTCAAGACCTrC) using T4 RNA Ligase 1 (NEB, M0437M). Ribosomal RNA (rRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1/20th of the annealed substrates was 5′-end-labelled with [γ-32P]-ATP and T4 polynucleotide kinase (New England Biolabs). For fluorescently labeled HJ40 substrates ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of RCA amplicons were treated with T7 endonuclease 5 μL of 10× reaction buffer and 1 μL of T7 endonuclease I (New England Biolabs, M0302S) in a 50 μL reaction volume ...
-
bioRxiv - Immunology 2023Quote: ... The digested and purified inset and vector were ligated at a ratio of 5:1 using T4 DNA ligase (NEB, M0202) overnight at 18°C ...
-
bioRxiv - Genomics 2023Quote: ... The pellet was resuspended in 90 µL of freshly prepared Micro-C “Master Mix 1” (10 μl 10x T4 DNA Ligase Buffer, 75 μl ddH2O, 5 μl T4 PNK (NEB #M0201L)) ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were diluted at a 1:5 ratio with H2O prior to qPCR using Luna Universal qPCR Master Mix (New England Biolabs, #M3003) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3’ deoxy-adenine overhangs were added using Klenow Fragment (NEB), the sample was purified with QIAquick column ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions contained 3 µL of BSA (New England Biosciences (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 μl AnP stock (5,000 units/ml, New England Biolabs) was added to 50 μM purified CST in Buffer A along with 0.5 mM ZnCl2 and 1mM MgCl2 ...