Labshake search
Citations for New England Biolabs :
1001 - 1050 of 1299 citations for Mouse Anti Hepatitis C Virus NS4b Antibody 1858 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... then the mixture was cooled to room temperature (∼22 °C) prior to immediate transformation into NEB Stable chemically competent bacteria (NEB #C3040H).
-
bioRxiv - Microbiology 2023Quote: ... Two μl of a 1:250 dilution of the annealed oligos were ligated to 50 ng of dephosphorylated BsaI-digested vector at 16°C overnight in 20 μl final volume containing 1x T4 DNA ligation buffer (NEB, B0202S), and 400U T4 DNA ligase (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated at 37°C for 20 min followed by dephosphorylation with 1 U Shrimp Alkaline Phosphatase (rSAP, New England Biolabs, #M0371S) and incubation for another 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equivalent amounts of gDNA from the different cells lines was digested in a 37°C water bath for four hours with HpaII and MspI isochizomer enzymes (NEB, Inc.) Following digestion ...
-
bioRxiv - Microbiology 2023Quote: ... A 3x HA-tag was fused to the C-terminal region of the amplified product along with the 3’UTR formed through Gibson assembly master mix (NEB, E2611S). To generate the PfMORC-HA knockdown constructs ...
-
Nucleolar Pol II interactome reveals TBPL1, PAF1, and Pol I at intergenic rDNA drive rRNA biogenesisbioRxiv - Molecular Biology 2023Quote: ... The isolated DNA was then resuspended in TE buffer and incubated overnight at 37°C with HindIII (New England Biolabs (NEB), Cat# R01045) ...
-
bioRxiv - Molecular Biology 2023Quote: ... paired oligonucleotides were incubated at 37°C for 30 min in a reaction mixture supplemented with T4 PNK (NEB, Massachusetts, USA) and T4 Ligation Buffer (NEB ...
-
bioRxiv - Genomics 2023Quote: MChIP-C NGS libraries were prepared from immunoprecipitated DNA with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... For the restriction digest 1 µg of genomic DNA from UACa20 and als4112Δ was incubated for 1 hour at 37 °C with the restriction endonuclease BamHI-HF (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Positive colonies were incubated overnight at 37°C and plasmids were isolated using the Monarch Plasmid Miniprep Kit (New England Biolabs, T1010L). For all assembled plasmids the sequence was confirmed by Sanger sequencing ...
-
A synthetic elastic protein as molecular prosthetic candidate to strengthen vascular wall elasticitybioRxiv - Cell Biology 2023Quote: ... pET30a-SEP vector was stored at -20°C prior to transform BL21 (DE3) competent bacteria (New England Biolabs, Évry-Courcouronnes, France).
-
bioRxiv - Genomics 2023Quote: ... The pellet was resuspended in 90 µL of freshly prepared Micro-C “Master Mix 1” (10 μl 10x T4 DNA Ligase Buffer, 75 μl ddH2O, 5 μl T4 PNK (NEB #M0201L)) ...
-
bioRxiv - Cell Biology 2023Quote: ... Restriction enzyme was inactivated using 1.6% of SDS for 25 minutes at 65°C and chromatin was ligated by adding 4000 U of T4 ligase (New England Biolabs, M0202M) in 1× T4 DNA ligase buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplification of 4 µl circularized cDNA was performed in a reaction volume of 48 μl in the presence of 500 nM PCR forward primer (AATGATACGGCGACCACCGAGATCTACA*C, where * is a phosphorothioate bond) and indexed NEBNext® Multiplex Oligoes for Illumina (NEB), 0.48 U KAPA HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... Insert and vector were combined at a 5:1 ratio and held at 50 °C for 1 hour in NEBuilder® HiFi DNA Assembly Master Mix (NEB). Gibson assembly products were purified using the MinElute® PCR Purification Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The tube containing the plugs was then cooled to 42°C before adding 5 µl of Beta-Agarase I (New England Biolabs, M0392) and incubating at 42°C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... C terminal and αPKC binding region) or PICK1 (BAR domain) were made with NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520S). Mutations of PICK1 (KD-AA and 5K-E ...
-
bioRxiv - Molecular Biology 2024Quote: ... The biotin handle and cosmid-I95 DNA were both digested for 2 h at 37 °C with SpeI-HF (New England Biolabs, R3133L) and subsequently heat-inactivated for 20 min at 80 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... The rbpms2bsa9329 surrounding genomic region was amplified for 35 cycles with an annealing temperature of 60°C and the mutant allele was digested with MboII (New England Biolabs, R0148S)2 or the wild-type allele was digested with HphI (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around rbpms2aae30 was amplified for 35 cycles with an annealing temperature of 60°C and the wild-type allele was digested with HaeIII for 1 hour (New England Biolabs, R0108S)2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The surrounding tsc2vu242 genomic region was amplified for 35 cycles with an annealing temperature of 57°C and the wild-type allele was digested with HpyCH4IV for 1 hour (New England Biolabs, R0169S). Undigested and digested products were resolved in a 3% Metaphor 1:1 (Lonza)/agarose gel (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were then coupled to protein G beads (New England Biolabs). After beads were washed ...
-
bioRxiv - Plant Biology 2021Quote: ... Beads with immobilized antibodies were collected through magnetic separation rack (NEB). Beads were washed with protein extraction buffer for 1 minute ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cell lysates were incubated with H4K5 Bu antibody (PTM Biolabs) or preimmune IgG per sample and 25 μl of magnetic protein G Dynabeads (catalog no ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibodies used were: TDP-43 (New England Biolabs, NEB, #G400), HTT (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibodies used were: TDP-43 (New England Biolabs, NEB, #G400), HTT (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antibodies used are as follows: pan-acetyllysine (PTM-Biolabs PTM-105), pan-butyryllysine (PTM-Biolabs PTM-301) ...
-
bioRxiv - Cell Biology 2023Quote: ... incubations were performed with primary rabbit antibody against N6-methyladenosine (NEB) or PAB2 (courtesy of Cecile Bousquet-Antonelli and Rémy Merret ...
-
bioRxiv - Genomics 2020Quote: ... Adapter ligation (AMX) was performed at RT (20 °C) for 20 minutes using NEB Quick T4 DNA Ligase (New England Biolabs, MA, USA). The reaction mixture was purified using 0.6X AmPure beads (Beckmann Coulter ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNA was then treated with DNase for 10 min at 37 °C to remove genomic DNA [10 μg RNA in 100 μl reaction buffer with 2U DNase I from NEB (Ipswich, MA)] followed by phenol-chloroform extraction and ethanol precipitation.
-
bioRxiv - Synthetic Biology 2019Quote: Extension reactions on single-stranded DNA were performed similarly to the reactions with Duplase enzymes described above for 60 minutes at 60°C using 2U Vent (NEB, Ipswich, MA), 2U Deep Vent (NEB) ...
-
bioRxiv - Systems Biology 2019Quote: ... The cDNA inserts were PCR-amplified using primers specific for either the N- or C-terminal libraries using Phusion DNA polymerase (New England Biolabs, Ipswich, MA). Amplicons were PCR-purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genetics 2021Quote: ... the poly (A) product was broken into pieces at 94 °C for 5-7 min using the Magnesium RNA Fragmentation Module (NEB, MA, USA). The RNA fragments were then reverse-transcribed using the SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... These were ligated to modified Illumina P1 and P2 adapters overnight at 16 °C with 1,000 units of T4 ligase (New England Biolabs, Beverly, MA, USA), followed by a 10-minute heat-deactivation step at 65 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated nucleotides from the non-ligated DNA ends were removed by incubating the Hi-C libraries (2 μg) in the presence of 6 U of T4 DNA polymerase (NEB; Cat#: M0203L) in NEBuffer 2.1 supplied with 0.025 mM dATP (Thermo Fisher ...
-
bioRxiv - Biochemistry 2021Quote: ... for 2 hr at 60 °C and relinearized at the basic dSpacer furan with Ape 1 (15 U; M0282S, NEB, Ipswich, MA) for 2 hr at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Hi-C library for Illumina sequencing was prepped by NEBNext® Ultra™ II DNA library Prep Kit for Illumina (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The Hi-C library for Illumina sequencing was prepared using the NEBNext® Ultra™ II DNA library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each plug was melted in 200 µl TE at 68 °C for 30 minutes and then digested using β-agarase I (BioLabs, M0392L) at 42 °C overnight ...
-
bioRxiv - Physiology 2022Quote: ... from epithelium or sensory neurons underwent digestion for 10 hours at 37°C with MspI restriction enzyme (New England Biolabs, Ipswich, MA), followed by purification with AMPure XP (Beckman Coulter ...
-
bioRxiv - Immunology 2022Quote: ... the tdTomato gene (codons optimized for expression in C. burnetii) was amplified by PCR with Q5 polymerase (New England Biolabs, Frankfurt, Germany) using primers a533 (5’-GATTTAAGAAGGAGATCTGCAGATGGTGTCAAAAGGAG-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... The solution was transferred to 42°C for 15 min and incubated overnight in 3 U of β-agarase I (New England Biolabs, M0392). Next ...
-
bioRxiv - Physiology 2021Quote: ... and 72 °C for 5 min) using a Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, Ipswich, MA, USA) and primers containing the restriction sites of SpeI or BglII for subsequent subcloning (F ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR reactions were pooled and treated for 1 hr at 37°C with 25 U of Exonuclease I (NEB, Cat# M0293S) per 100 μL of pooled PCR reactions ...
-
bioRxiv - Developmental Biology 2022Quote: ... <200nt isolates were immediately frozen at -80⍰°C while >200nt isolates were used as template for cDNA synthesis (LunaScript RT Mastermix Kit, New England Biolabs, MA, USA) and subsequent doublesex sexing PCR as previously described (25) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.5 μM DTT) and incubated for 30 minutes at 37°C in the presence of 1000 gel units of MNase (#M0247S, NEB, Ipswich, MA) in 300 μl volume of buffer B ...
-
bioRxiv - Immunology 2020Quote: ... G and C and lower case ‘g’ represents RNA bases) and the uracil-containing primers subsequently removed by treatment with UDG (NEB, Hitchin, UK). TRA and TRB sequences were amplified using a pair of 5’ ‘step-out’ primers specific for the SMART oligo (long 5’ primer - CTA ATA CGA CTC ACT ATA GGG CAA GCA GTG GTA TCA ACG CAG AGT ...
-
bioRxiv - Synthetic Biology 2021Quote: All plasmid vectors were prepared by Qiagen midi prep and 10-20 ug of DNA linearized by digest with KpnI-HF and XbaI restriction enzymes at 37°C in NEB Cutsmart buffer with enough units of activity to generate ~5X overdigest in two hours (New England Biolabs, Ipswich, MA). Reaction was stopped and DNA partially purified by NaCl/Isopropanol precipitation followed by three 70% Ethanol washes and resuspension in 1 mM Tris-HCl ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A-tails were added by mixing the purified end-repaired DNA with dATPs and Klenow exonuclease and incubating at 37° C for 30 minutes (NEB, Ipswich, MA) and then purified using the Qiagen QIAquick PCR purification kit (Qiagen ...