Labshake search
Citations for New England Biolabs :
751 - 800 of 1299 citations for Mouse Anti Hepatitis C Virus NS4b Antibody 1858 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription (IVT) was performed at 37°C for 13-16h with the HiScribe T7 RNA Polymerase kit (NEB). The remaining DNA was digested by Turbo DNase I (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... Ligation of the fragmented RNA to the MARS-seq adapter was performed at 22°C for 2h with T4 RNA ligase (NEB) followed by a 1.5X AMPure XP bead cleanup ...
-
bioRxiv - Molecular Biology 2022Quote: ... 200 fmol of input cDNA were incubated for 20 minutes at room temperature (15–25°C) with the native barcodes and Blunt/TA Ligase Master Mix (New England Biolabs), followed by 10 minutes at 65°C.
-
bioRxiv - Genomics 2022Quote: ... The purified gDNA was digested at 37 °C with five restriction enzymes (EcoRI, BsrGI, XbaI, SspI and HindIII from NEB). Ten micrograms of digested gDNA was incubated with 7 μg of S9.6 antibody (Millipore ...
-
bioRxiv - Biophysics 2022Quote: ... The DNA fragment was amplified by PCR by inserting a C-terminal 6x His tag and cloned into the pETDUET-1 vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Developmental Biology 2022Quote: ... coli and by performing heat shock for 30 seconds at 42°C followed by recovery in SOC outgrowth medium (NEB) for 1 hour ...
-
bioRxiv - Biochemistry 2022Quote: ... Six histidine residues were added to the C-terminus of the sequence via the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The resulting vector was transformed into OverExpress C41(DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were performed at 80 °C for 60 minutes and terminated by the addition of 1 μL of Proteinase K (NEB). Cleavage fragments from pre-linearized substrates were purified using paramagnetic beads and quantified and analyzed as described above ...
-
bioRxiv - Cancer Biology 2022Quote: ... were then ligated overnight at 16°C with the dA-tailed DNA fragments in the presence of 800 units of T4 DNA ligase (NEB) and 1 mM ATP (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... digestion at 37°C for 30 minutes and then purified with the Monarch RNA Cleanup Kit (T2050, New England Biolabs) for long RNA (1020 nucleotides to 4187 nucleotides ...
-
bioRxiv - Biophysics 2022Quote: ... The agarose was digested by 1 hour incubation at 42 °C with 2 units of beta-agarase (M0392, New England Biolabs). After this stage ...
-
bioRxiv - Genomics 2022Quote: ... Digestion was performed overnight by adding 50 μL of DpnII (Capture-C) or HindIII (5C) buffer and 10 μL of high-concentration DpnII or HindIII (NEB) and incubating samples at 37°C in a thermomixer ...
-
bioRxiv - Cell Biology 2022Quote: INS-1 832/3 EV and g1-2 cells transiently expressing the SNAP-GLP-1R were labelled at 37°C with 1 μM of SNAP-Surface 649 fluorescent substrate (S9159S, New England Biolabs) in full media prior to treatment with 100 nM exendin-4 or vehicle for 3 hours ...
-
bioRxiv - Microbiology 2021Quote: ... The repair templates used for the introduction of the C-terminal tags (YFP and SNAP) were amplified by PCR (Q5 polymerase, New England Biolabs) from template plasmids ...
-
bioRxiv - Microbiology 2021Quote: ... and following the KLD enzyme step the product was heated to 65°C for 20 minutes and then double digested with PseI and FseI in CutSmart buffer (NEB) for 60 minutes at 37°C to remove any remaining plasmid that was not eliminated by the DpnI in the KLD step ...
-
bioRxiv - Microbiology 2020Quote: ... Ligation of the product and linearized vector was performed overnight at 14°C with T4 DNA ligase (New England Biolabs). The resulting construct was transformed into DH5α Escherichia coli by heat shock and transformants were obtained by selection on LB agar with carbenicillin and X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 6 h at 37°C in the absence or presence of RNase H or RNase A (40 U, NEB). Digested nucleic acids were cleaned with phenol-chloroform extraction and resuspended in nuclease-free water ...
-
bioRxiv - Microbiology 2021Quote: ... Ligation of gRNA sequence into the plasmid was made using a T4 DNA ligase at 16°C overnight and transformed into DH5α chemically competent bacteria according to the manufacturer protocol (NEB). The presence of the new gRNA into pCas9-amdSYM was confirmed by Sanger sequencing using the M13 forward primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Coverslips were treated with RNase A (Fermentas) for 1 hour at 37°C and where indicated with RNase H (NEB) for 24 hours at 37°C prior to blocking ...
-
bioRxiv - Cell Biology 2020Quote: ... Four hundred ng of total RNA extracted from pools of 250 mouse oocytes was ligated to 400 ng of P1 anchor primer (5’-P-GGT CAC CTT GAT CTG AAG C-NH2-3’) in a 10-µl reaction using T4 RNA ligase (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Physiology 2020Quote: ... A V5 tag was appended to the C terminus of the open reading frame using Phusion site-directed mutagenesis (New England Biolabs) to generate a V5 tagged version of mouse ANGPTL4 (pHS5) ...
-
bioRxiv - Molecular Biology 2022Quote: ... MCC libraries were generated by digesting the chromatin in low Ca2+ MNase buffer (10 mM Tris-HCl pH7.5, 10 mM CaCl2) for 1 h at 37°C with MNase (NEB, M0247) added in varied concentrations (17-19 Kunitz U) ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were incubated for 45 min at 37°C and then transferred to a tube containing the ligation reaction (160 µL NEB ligation buffer 10X ...
-
bioRxiv - Microbiology 2022Quote: ... gDNA fragments were ligated with annealed adaptors overnight at 16 °C in the presence of T4 DNA ligase (NEB#M0202). Bands from 200 to 400 bp were selected by extraction from a 2% agarose gel using a Monarch DNA Gel Extraction Kit (NEB#T1020L) ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA synthesis was performed for one hour at 42 °C using M-MuLV Reverse Transcriptase (New England Biolabs). Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... Proteins were pre-incubated at 4°C for 30 min before addition of 100 uL equilibrated amylose resin (New England BioLabs). The mixture was incubated for 1h at 4°C ...
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: ... 1 unit of λ-phosphatase is defined as the amount of enzyme that hydrolyzes 1 nmol of p-nitrophenyl phosphate in 1 minute at 30°C (New England Biolabs). After 45 minutes of incubation ...
-
bioRxiv - Biophysics 2019Quote: ... and 15-25 μM of BG-oligonuculeotides were labeled with ∼ 1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2019Quote: A total amount of 20 µg genomic DNA was digested overnight at 37°C with 100 U EcoRV or XbaI or BamHI or HindIII (New England Biolabs) in independent reactions ...
-
bioRxiv - Genomics 2019Quote: ... LB plates at 10-fold dilutions to 1/10,000 and grown overnight at 37°C and the remainder of the cells were left in SOC (New England Biolabs) at 4°C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... followed by heat inactivation for 10 min at 80°C and overnight ligation at a 1:3 vector-to-insert ratio using T4 DNA Ligase (NEB) at 4°C ...
-
bioRxiv - Genomics 2019Quote: ... were annealed to form adapters by incubating at 85°C for 10 min in 1x T4 DNA ligase buffer (NEB) before cooling gradually by transferring the heated block to the bench before dilution in 1x T4 DNA ligase buffer to working concentrations.
-
bioRxiv - Genetics 2019Quote: ... DNA samples were incubated at 20°C for 4h without rotation in a mix of 10 µl of 10x NEB2 buffer (New England Biolabs), 1 mM of a dNTPs mix (10 µl) ...
-
bioRxiv - Biochemistry 2019Quote: ... Those fractions containing the protein of interest were pooled and incubated 30 minutes at 4°C with pre-equilibrated amylose resin (New England BioLabs) and eluted with elution buffer (30 mM HEPES pH 8.0 ...
-
bioRxiv - Systems Biology 2020Quote: Digested DNA was heated to 50° C for 5 minutes to melt paired sticky ends then put into a 200 μL Klenow fragment (exo-, NEB) fill-in reaction containing 36 μM biotin-14-dCTP (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... The treated RNA samples were incubated with 100 μM RNA rP5_RND oligo (final 10 μM, Table S3) 2h at 25°C with 10 Units of T4 RNA ligase 1 (NEB). Please note that we used an RNA oligo ...
-
bioRxiv - Cancer Biology 2020Quote: ... eluted in 8 μl and in vitro transcribed (with the beads) at 37 °C overnight for linear amplification using the T7 High Yield RNA polymerase IVT kit (NEB). Following IVT ...
-
bioRxiv - Biochemistry 2020Quote: ... SMN-Gemin2 complex was produced by co-expression of SMN (residues 1-294) and Gemin2 (12-280) fused to a C-terminal Mxe intein (NEB) containing a hexahistidine tag ...
-
bioRxiv - Biochemistry 2020Quote: ... Hartmann Analytic) for 30 min at 37°C in 50 µl volumes with 20 units of T4 PNK (New England Biolabs) in the provided reaction buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Inserts were then incubated for 1 hour at 37°C in the presence or absence of SssI methylase (New England BioLabs). The efficiency of the methylation reaction was verified by resistance to cleavage by the methylation-sensitive restriction enzyme HpaII (New England BioLabs) ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial lysis was completed by incubating for 3 h at 55°C in the presence of 1% SDS and 100 μg/ml proteinase K (NEB). Lysates from both methods were extracted twice with equal volumes of phenol– chloroform–isoamyl alcohol (25:24:1) ...
-
bioRxiv - Biophysics 2021Quote: ... and 15–25 μM BG-oligonuculeotides were labeled with ∼1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... chromatin from both IP and ‘Input’ samples were eluted and de-crosslinked at 65°C for 16 hours followed by DNA isolation by PCR and DNA cleanup kit (NEB). Enrichment of AR and MED1 at specified enhancers were quantified by qPCR using specific primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR of 10 cycles with an annealing temperature 61°C was performed using Q5 High-Fidelity DNA Polymerase (#M0491S, New England Biolabs) and BEL and AL primers on 5μL of I-SceI digested DNA purified from the ChIP procedure ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... were fused to the fluorescent protein mNeonGreen with a C-terminal linker and cloned into pJBL044 under the constitutive promoter Pveg using Gibson assembly (New England Biolabs). The original pJBL044 plasmid was constructed using isothermal assembly from a fragment of pDR160 (Bose and Grossman 2011) ...
-
bioRxiv - Microbiology 2021Quote: ... and cloned to the C terminus of a 11 His-tagged maltose-binding protein in a pMAL-C5X vector (New England Biolabs) separated by a cleavage site for tobacco etch virus protease ...
-
bioRxiv - Cancer Biology 2020Quote: ... was stored at 20° C or amplified immediately in 50 μl reactions with high-fidelity 2X PCR Master Mix (New England Biolabs) using a common forward primer and different reverse primers with unique barcodes for each sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Region B or Region C were used as templates for in vitro transcription by HiScribe T7 quick high yield RNA synthesis kit (NEB). The obtained RNA products were converted back to DNA oligo probes via reverse transcription (RT ...
-
bioRxiv - Biophysics 2021Quote: ... Two experiments were conducted in which the vacuum filling of the channels with buffer was followed by a heating/diffusion step of 1 hour at 40°C with the reservoir filled with a solution containing both DNase I (at 0.096U/μl) and BSA (NEB B9000S) at 0.13mg/ml or 0.40mg/ml ...