Labshake search
Citations for New England Biolabs :
9851 - 9900 of 10000+ citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... and 0.5–50 ng of DNA/ChIP was used for library preparation using the NEBNext Ultra II DNA Library Kit for Illumina (NEB E7645) and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of RNA was used as input for library preparation using the NEBNext Multiplex Small RNA Library Prep Kit for Illumina (NEB E7560S), according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... The spheres were collected after 24 h and RNA extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs #T2010S). RNA was extracted from adherent cells directly from the plate ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was collected from parental iOvCa147 cells and DYRK1A-/-cells from 24-hour adherent or 6-hour spheroid conditions using the Monarch Total RNA Miniprep Kit (NEB #T2010S) as described above ...
-
bioRxiv - Cell Biology 2024Quote: ... The Tg-FLAG gene was then amplified and assembled with an empty pcDNA5/FRT expression vector using a HiFi DNA assembly kit (New England BioLabs, E2621). This plasmid then underwent site-directed mutagenesis to produce pcDNA5-C1264R-Tg-FLAG ...
-
bioRxiv - Microbiology 2024Quote: RdnE proteins were produced using the New England Biolabs PURExpress In Vitro Protein Synthesis Kit (New England BioLabs Inc., Ipswich MA). Template DNA contained the rdnE gene and required elements specified by the PURExpress kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA sequencing libraries were generated using the poly-A selection module in the NEBNext UltraII Directional RNA Library Prep Kit (NEB E7760) and sequenced on the Illumina HiSeq 2500 sequencer with single-end 50 cycles ...
-
bioRxiv - Cell Biology 2024Quote: RNA encoding indicated HSP90B1 nascent chains were prepared from PCR amplified and purified DNA template containing a T7 promoter and carried out at 37°C for 2 hours using the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2024Quote: ... Adaptor-ligated DNA fragments of proper size were enriched with PCR reaction using Phusion High-Fidelity PCR Master Mix kit (NEB, M0531S) and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1 ...
-
bioRxiv - Cell Biology 2024Quote: The deadenylase dead mutation (D1020A) in PAN2’s coding sequence was generated by site-directed mutagenesis (Q5 Site Directed Mutagenesis Kit from NEB E0554) with primer pairs 5’ GGTTTGAATAATGCCTTCAAACACATTAATATTAATGTC 3’ and 5’ ATGACCAACAAATACATTATTCAAACCATGACCAAC 3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA isolation module for samples with RINs greater than 7 and libraries were prepared using the NEBNext Ultra II directional RNA library preparation kit (NEB, E7760). QC was then performed on these libraries using an Agilent Bioanalyzer 2100 and the libraries were quantified using fluorometric methods ...
-
bioRxiv - Bioengineering 2024Quote: Samples were resuspended in 5 µl 1X NEBNext Cell Lysis Buffer of the NEBNext Single Cell/Low Input RNA Library Prep Kit (NEB, E6420). After 5 min incubation at RT ...
-
bioRxiv - Biochemistry 2024Quote: Active site mutations of PqqU were generated from the plasmid template pBAD24-pqqU using the Q5® Site-Directed Mutagenesis Kit (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... mRNA was fragmented into short fragments using fragmentation buffer and reverse transcribed into cDNA using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). Purified double-stranded cDNA fragments were end-repaired ...
-
bioRxiv - Cell Biology 2024Quote: ... Site directed mutagenesis was performed according to the manufacturer’s instructions to introduce gRNA target-site mutations in wild-type Pcyt2 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554). Primers were designed using NEBaseChangerv1.
-
bioRxiv - Biochemistry 2024Quote: The pET15b-CtTrl1-LIG plasmid22 served as template for PCR-based site direct mutagenesis with one oligonucleotide for K148N and E328-stop (ΔCTD) variants or two oligonucleotides and Q5® Site-Directed Mutagenesis Kit (NEB) to introduce R334A ...
-
bioRxiv - Cancer Biology 2024Quote: ... C1-deleted pMYs-CIC::DUX4-IRES-EGFP was cloned from pMYs-CIC::DUX4-IRES-EGFP (a gift from Takuro Nakamura (52) and Michael Kyba (25)) using the Q5 Site-Directed Mutagenesis Kit (NEB E0554S) with the primers described in Supplemental Dataset S2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mutagenesis was carried out in the PTPRH WT-HA plasmid using the Q5 Site-Direct Mutagenesis Kit (New England Biolabs #E0554) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: Plasmids encoding TALE-free MTS–G1397-split DddAtox/DddA6/DddA11–UGI were generated with the Q5® Site-Directed Mutagenesis (SDM) Kit (NEB), using the corresponding herein developed backbone plasmids as templates for each final construct containing either the DddAtox ...
-
bioRxiv - Cell Biology 2024Quote: ... Individually barcoded strand-specific libraries for mRNA sequencing were prepared from total RNA samples of high quality (approximately 150 ng per sample) using the NEBNext® RNA Ultra II Directional RNA Library Prep Kit (New England Biolabs) for 12 PCR cycles on the liquid handler Biomek i7 (Beckman Coulter GmbH ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 ng of the PCR product was used in an in vitro transcription reaction using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, E2040S). The DNA template was digested through addition of DNase I after in vitro transcription ...
-
bioRxiv - Microbiology 2024Quote: ... Gaussia luciferase and Cypridina luciferase expression levels were measured with a Biolux Gaussia luciferase assay kit (New England Biolabs, USA; #E3300) and Biolux Cypridina luciferase assay kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... was used to identify 5-methylcytosine and 5-hydroxymethylcytosine bases and sequencing libraries were constructed by NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, #E7645S), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing libraries were prepared from 20 uL of ChIP DNA using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S). Library molarity and quality were assessed by Qubit and Tapestation (DNA High sensitivity chip) ...
-
bioRxiv - Microbiology 2024Quote: Library preparation and sequencing were conducted using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina with dual index primers and ∼300 ng of DNA (NEB Inc.) on an automation platform (Biomeki5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by fragmentation and the cDNA library preparation using the NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Reaction mixtures were treated with DNase I and incubated at 37 °C for 30 minutes before immediate purification (Monarch® RNA Cleanup Kit, NEB). A sample of each mRNA was reserved for quality analysis and transcripts were tailed with E ...
-
bioRxiv - Immunology 2024Quote: ... RNA aliquots were used for library preparation using NEBNext Multiplex Small RNA library preparation kit (New England Biolabs, Ipswich, MA, USA). The PCR amplified cDNA construct (from 140–160 bp ...
-
bioRxiv - Molecular Biology 2024Quote: DICER RNA substrates have been obtained using PCR synthetized linear DNA bearing T7 promoter and HiScribe T7 High Yield RNA Synthesis Kit (NEB #E2040S) following manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Length of DNA Fragments were determined by agarose gel electrophoresis and then purified with Monarch DNA Gel Extraction Kit (NEB # T1020L). DNA concentration has been assessed by Nanodrop.
-
bioRxiv - Molecular Biology 2024Quote: ... the immunoprecipitated DNA was subjected to end repair and adaptor ligation reactions using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, E7645), according to the manufacturer instruction ...
-
bioRxiv - Microbiology 2024Quote: ... was digested with XbaI and MluI restriction enzymes and barcoded linear HA libraries were inserted into the lentivirus backbone using NEB HiFi assembly kit (NEB E5520S). Assembled plasmid libraries were then electroporated into electrocompetent 10b cells (NEB C3020K ...
-
bioRxiv - Neuroscience 2024Quote: ... Stranded RNA sequencing libraries were prepared as described using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB E7760L). Purified libraries were qualified on an Agilent Technologies 4150 TapeStation using a D1000 ScreenTape assay (5067-5582 and 5067-5583) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plasmids were transcribed in-vitro using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs Cat No. E2050S) to produce RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing libraries were prepared by the EPFL Gene Expression Core Facility using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, #E7760S), and sequenced on a NovaSeq6000 using 75-nucleotide read length paired-end sequencing.
-
bioRxiv - Neuroscience 2024Quote: ... long amplification of the CHRFAM7A intron (exon A to exon 5) was carried out with the LongAmp® Taq DNA Polymerase Kit (ref. E5200S, New England Biolabs), according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: Total RNA from mouse glomeruli was sequenced on a HiSeq 4000 following standard workflow using NEBNext Ultra II RNA Library Preparation kit (New Englab Biolabs, MA)(Illumina ...
-
bioRxiv - Genomics 2024Quote: ... Illumina libraries were constructed from total RNA using the NEB Next Ultra Directional RNA Library Prep Kit (New England Biolabs, E7760) per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... pMT-mCherry-Rlip and pMT-Rlip-mCherry were cloned from pMT-Rlip-HA using NEB HiFi Assembly kit (NEB cat#E5520) to exclude the retained intron and incorporate the mCherry open reading frame into pMT-V5-His vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... The molecular barcoded ChIP-seq library was prepared with all ChIPed-DNA obtained using the NEBNext UltraII DNA library Prep kit (NEB, E7645S). The quality of the libraries was assessed on a Bioanalyzer (Agilent) ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... Library preparation was performed by EMBL Genomics Core Facility using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L), in combination with the NEBNext Poly(A ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... RNA was then extracted by adding an equal volume of RNA lysis buffer and proceeding with Monarch Total RNA Miniprep Kit (NEB #T2010S) extraction ...
-
bioRxiv - Synthetic Biology 2024Quote: Transcription templates for expressing gRNA variants and SARS-CoV-2 or CMV input RNA fragments were generated by PCR (Phusion high-fidelity PCR kit, NEB #E0553) of the gBlock or Ultramer template that included a T7 promoter and the gRNA or input RNA coding sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 ng of RNA were retrotranscribed into cDNA using a LunaScript™ RT SuperMix cDNA Synthesis Kit (NEB, Cat. No. E3010L) using the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Input control and HT-enriched samples were prepared for Illumina sequencing using NEBNext Ultra II Library Prep Kit for Illumina (NEB; E7645S) following manufacturer’s protocol and sequenced on Illumina NovaSeq 6000 2×150 with the UW-Madison Biotechnology Center at ∼10 million reads per sample.
-
bioRxiv - Genomics 2024Quote: ... The reaction was purified using the Zymo DNA Clean & Concentrator kit and PCR-amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and primers as defined in Corces et al ...
-
bioRxiv - Microbiology 2024Quote: ... and utilized for library constructions with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina along with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs; NEB; # E7760L). The libraries were sequenced on the NovaSeq platform as paired-end reads using the S1 v1.5 kit with 300 cycles (Illumina) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Barcoded mutant variants were then cloned into the cut vector using the NEBuilder HiFi DNA Assembly Kit (NEB, Cat. No. E2621) with a 1:3 insert to vector molar ratio in a 1 hour reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... the corresponding sgRNA was designed online (https://benchling.com) and was synthesized by using the HiScribe™ T7 RNA Synthesis Kit (NEB, E2050). The purified RNA and Cas9 protein (Cat1081058 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification of cDNAs was performed using a high-fidelity KOD-Plus-Neo DNA polymerase (Toyobo, Japan) and resulting PCR products were cloned using NEB® PCR Cloning kit (New England BioLabs). Positive clones and plasmids were verified by DNA sequencing.