Labshake search
Citations for New England Biolabs :
9451 - 9500 of 10000+ citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: The predicted late domain motifs encoded in TgGRA14 C-terminus were mutated in the pGagGRA14_Venus by site-directed mutagenesis (Q5 Site-Directed mutagenesis kit NEB, Cat#E0554S). Primers encoding mutation alanine substitutions for PTAP or YPXL were used to generate pGagGRA14TSG101-_Venus and pGagGRA14ALIX-_Venus (P11 + P12 and P13 + P14) ...
-
bioRxiv - Developmental Biology 2021Quote: ... IRES-Puro and an FRT-flanked PGK-hygromycin selection cassette to generate the targeting vector using the NEBuilder High-Fidelity DNA Assembly Cloning Kit (NEB, E5520). Twenty-one bp downstream of the start codon ...
-
bioRxiv - Immunology 2021Quote: ... Twenty ng of purified PCR product was used as input for library construction using the NEBNext Ultra II FS DNA Library Prep Kit (NEB, E6177S) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription reactions were performed with 6 μl of purified RNA and random primers using the NEB ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and all mutant forms of NMA1 were created using a Q5 site-directed mutagenesis kit (New England Biolabs, Ispwich, MA, USA).
-
bioRxiv - Neuroscience 2021Quote: ... We amplified and prepared these libraries for sequencing with the NEB Next Ultra RNA Library Prep Kit (New England Biolabs E7530S) and NEBNext multiplex oligos for Illumina (NEB E7335S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Genomics 2021Quote: ... and libraries were generated from 250 ng starting material with NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs E7765). Libraries were sequenced on an Illumina NextSeq 500 with 150 bp paired-end reads.
-
bioRxiv - Genomics 2022Quote: ... 100 ng of the resulting 5C product was prepared for sequencing on the Illumina NextSeq 500 using the NEBNext Ultra DNA Library Prep Kit (NEB E7370) following the manufacturer’s instructions with the following parameter selections ...
-
bioRxiv - Pathology 2021Quote: ... in an Applied Biosystems StepOnePlus Real-Time PCR System (USA) and tracked with a DNA-intercalant green fluorophore provided with the WarmStart LAMP Kit (NEB, USA). The RT-LAMP amplification was set to 45 minutes for experiments illustrated in Figures 2 ...
-
bioRxiv - Biophysics 2021Quote: ... RNA aliquots were used for library preparation using NEBNext Multiplex Small RNA library preparation kit (New England Biolabs, Ipswich, MA, USA). The PCR amplified cDNA construct (from 140–160 bp ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1μg of total RNA from each sample was reverse transcribed into cDNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... A D10A mutation was introduced by site-directed mutagenesis of the original Puro-Cas9 donor with the Q5 mutagenesis kit (New England Biolabs, E0554S) to generate the Cas9n ...
-
bioRxiv - Developmental Biology 2021Quote: ... The gRNA templates were amplified by PCR with scaffold reverse primer then were transcribed with HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) [22] ...
-
bioRxiv - Biophysics 2020Quote: ... Single point mutations in KIF1A were generated by the NEB Q5® site-directed mutagenesis kit (New England Biolabs Inc. #E0554S) and confirmed by sequencing.
-
bioRxiv - Cell Biology 2020Quote: ... A STOP codon was introduced at the end of the coding sequence of FLAG-UBE2K using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs GmbH) according to the manufacturer’s instructions and the primers TGATTGGACCCAGCTTTCTTG and GTTACTCAGAAGCAATTCTG.
-
bioRxiv - Cell Biology 2020Quote: ... Two missense point mutations present in the initial plasmid (c1411t and c2671t) were corrected using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S) according to manufacturer protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Antisense probes were converted to RNA from this template using the HiScribe™ SP6 RNA synthesis Kit (New England BioLabs, E2040S). Sense probes were converted to RNA from this template using the HiScribe™ T7 RNA synthesis Kit (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... Sense probes were converted to RNA from this template using the HiScribe™ T7 RNA synthesis Kit (New England BioLabs, E2070S). In each RNA synthesis reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... Mutant constructs (fam83faF275A, fam83faF279A and fam83faF275/279A) were generated by site-directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... and 1 μg of purified PCR product was used as template for in vitro transcription using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, E2040S) as described by the manufacturer.
-
bioRxiv - Genomics 2020Quote: ... Novogene prepared a PCR-free Illumina sequencing library using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, USA), with the manufacturers protocol modified to give a 500 bp – 1 kb insert size ...
-
bioRxiv - Microbiology 2021Quote: ... The seven PCR products were assembled into the pCC1-F567-mNG plasmid that were pre-linearized with NheI and XhoI by using the NEBuilder® HiFi DNA Assembly kit (NEB) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2020Quote: ... RNA sequencing libraries were prepared from 500 ng of each total-RNA sample using the NEBNEXT Ultra II Directional RNA Library Prep kit with Poly-A mRNA magnetic isolation (NEB #E7490) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... or more amino acid substitutions in SecPH with Q5 PCR methodology (Q5®Site-Directed Mutagenesis Kit, New England Biolabs, E0554) or PCR site-directed mutagenesis strategy ...
-
bioRxiv - Molecular Biology 2021Quote: ... For the library preparation the NEBNext® Ultra™ II DNA Library Prep Kit from NEB (New England Biolabs, Ipswich, MA) was used ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were assembled from fragments (linearized vector, PCR products, and/or synthetic DNA) using the NEBuilder Hifi DNA assembly kit (New England Biolabs (NEB) E2621) ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Immunology 2021Quote: ... were generated by introducing the corresponding amino acid mutations (Extended Data Fig. 5) using the Q5® Site-Directed Mutagenesis Kit (NEB) and per manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2020Quote: ... and quantified using qPCR with the NEBNext® Library Quant Kit for Illumina® (New England Biolabs® Inc., MA, USA). Following qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... The OprCAA mutant was produced by changing the key amino acids Cys143 and Met147 to alanine residues using the KLD Quickchange site-directed mutagenesis kit (New England Biolabs, UK) and specific primers containing both mutation sites (forward ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were generated using NEBNext Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs; Ipswich, MA, USA), and the library quality was assessed on Qubit 3.0 Fluorometer (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB E7645) according to manufacturer instructions with a few modifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... and sequencing adaptors (5 μl) from the Ligation Sequencing Kit (ONT, #LSK109) and Quick T4 DNA Ligase (10 μl) (NEB, M2200S) were added to the cleaved and dA-tailed gDNA sample ...
-
bioRxiv - Molecular Biology 2021Quote: RT-LAMP reactions were performed using either WarmStart® Colorimetric LAMP 2X Master Mix (DNA & RNA) (M1800) or WarmStart® LAMP Kit (DNA & RNA) (E1700) from New England Biolabs (NEB). 40 mM guanidine hydrochloride was included in all reactions to improve LAMP reaction speed and sensitivity [10] ...
-
bioRxiv - Molecular Biology 2021Quote: Site-directed mutagenesis of the AP-1 binding sites in the distal enhancer reporter plasmids were performed using the Q5® Site-Directed Mutagenesis Kit (New England BioLabs). Primer pairs 5’-CCATAATGTGgggCTATACTAAATTTCATCTTC-3’ and 5’-CTAAATCCACTTAGAAAAAACAATC-3’ ...
-
Nucleo-cytoplasmic shuttling of splicing factor SRSF1 is required for development and cilia functionbioRxiv - Molecular Biology 2020Quote: ... The guide region was then amplified by PCR and paired guide RNAs synthesised by in vitro transcription (T7 Quick High Yield RNA Synthesis kit, NEB, #E2050S). Single stranded DNA oligonucleotides (WT oligo ...
-
bioRxiv - Microbiology 2021Quote: ... The ChIP libraries were prepared using NEBNext® UltraTM II DNA Library Prep Kit for Illumina (Catalog: E7645S, New England Biolabs). The samples were subjected to various enzymatic steps to repair the ends and tailing with dA-tail followed by an adapter ligation ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA-seq libraries were prepared from total RNA using polyA selection followed by the NEBNext Ultra II Directional RNA Library Prep Kit protocol (New England Biolabs, E7760S). Sequencing was performed on Illumina HiSeq 2500 instrument resulting in approximately 30 million of 50 bp reads per sample ...
-
bioRxiv - Immunology 2021Quote: ... captured mRNA was processed for Next Generation Sequencing (NGS) using the NEB Next Ultra II RNA Library Prep Kit for Illumina (New England Biolabs, UK). Quality was assessed on the Agilent 2100 Bioanalyser using the High Sensitivity DNA Kit (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... followed by adaptor ligation and enrichment with a low-cycle according to the instructions of NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB, USA). The purified library products were evaluated using the Agilent 2200 TapeStation and Qubit2.0 (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... according to the manufacturer’s instructions.29 RNA reverse transcription and first strand cDNA synthesis were carried out using chain-specific reverse primers30 with ProtoScript® II First Strand cDNA Synthesis Kit (NEB). The resulting cDNA was used as template for preparing the sequencing library using 5’ multiplex PCR as previously described.31 The PCR products corresponding to the library amplification were purified on BluePippin with size cutoff around 500 bp ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng of total RNA was used to generate RNA-seq library using NEBNext Ultra RNA Library prep kit (NEB, E7530L) according to the vendor’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Resultant DNA was gel extracted then 400 ng template used for in vitro transcription with the HiScribe RNA synthesis T7 kit (NEB, E2040) for 2 hours at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... BRCT domain (aa 560-777), BUDR (R705A, D712A, Q715R) were deleted or mutated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S). The GFP-BARD1 constructs were shuttled into a lentiviral destination vector containing a UBC promoter and a hygromycin resistance gene using the Gateway LR Clonase II Enzyme Mix (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... The digestion product was resolved on a 0.7% agarose gel and the plasmid backbone was purified using the Monarch gel purification kit (NEB, Cat# T1020S). The ‘T2A-GFP-WPRE’ sequence was inserted into the digested backbone using the Gibson Assembly kit (SGI ...
-
bioRxiv - Genomics 2021Quote: ... and the fragmented DNA was subjected to library preparation with NEBNext® Ultra II DNA Library Prep Kit for Illumina (E7645S, New England Biolabs). Sequencing was carried out on Illumina NovaSeq 6000 with 150bp paired end mode.
-
bioRxiv - Genomics 2021Quote: ... We prepared a total of 30 libraries using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc.). We selected an insert size of 300 bp by using a fragmentation time of 5-12 min ...
-
bioRxiv - Microbiology 2020Quote: ... The sequencing libraries were created using the NEBNext® Ultra™ II DNA Library Prep Kit (New England Biolabs, MA, USA). Coverage values are reported in Table 1 ...