Labshake search
Citations for New England Biolabs :
9551 - 9600 of 10000+ citations for Human Complement Component 1 Q Subcomponent Binding Protein HABP1 C1QBP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using primers containing the homology arm flanking the sgRNA region (replacing the BRD4 homology arm) and Gibson cloned (NEBuilder Hifi DNA assembly kit, NEB) into the same vector by digesting with MluI restriction enzyme.
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA libraries were constructed using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs, #E7760) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries for DNA fragments were prepared based on the NEBNext Ultra II DNA library prep Kit for Illumina (NEB#E7645).
-
bioRxiv - Molecular Biology 2024Quote: ... 25ul ChIP DNA or 10ng Input DNA were used to generate libraries using the NEBNext Ultra II Library Prep Kit for Illumina (NEB). Reactions were scaled down to half otherwise processing was according to the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... The repair template was assembled and integrated into pCC1 using Gibson assembly (Gibson et al., 2008) (NEB Hifi assembly kit). Colony PCR was used to check the plasmids had the correct inserts (F-93/R-91 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The sequencing library was generated by combining equal amounts of purified PCR products and quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs). The primer 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ was used to sequence on Illumina platforms.
-
bioRxiv - Microbiology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) using 200-600ng total RNA as input ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was poly-A selected and RNA-Seq libraries were prepared using NEBNext Library Prep Kit for Illumina (NEB #E7760). A Miseq shallow sequencing run was performed after library preparation to balance the sample loading process on the deep sequencer ...
-
bioRxiv - Cell Biology 2024Quote: ... domain from pmEGFP-N1-R-MCD(+0.2) plasmid (kind gift from Dr. Gregory Jedd) and cloned into XLone-GFP plasmid using Gibson assembly kit (NEB, E2611S). Two days after nucleofection ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) was prepared from total RNA (5 μg) by reverse transcription using LunaScript® RT SuperMix Kit (NEB). qPCR reactions were performed using Power SYBR Green Master Mix (Thermo ...
-
bioRxiv - Physiology 2024Quote: ... mRNA Magnetic Isolation Module was followed by library preparation using the NEBNext Ultra II RNA Directional Library Prep Kit for Illumina (New England BioLabs). Single read sequencing took place on a NextSeq 2000 System (Illumina) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR-amplified DNA templates encoding 5’UTR of ATF4 mRNA were used for in vitro transcription of ATF4 reporter mRNA using HiScribe T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2024Quote: ... and inserted into BamHI-HindIII-digested p413-PGPD vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs, E5520S).
-
bioRxiv - Cell Biology 2024Quote: ... Synthetic oligonucleotides encoding 3xFLAG were then ligated to the 5’ position of APEX2 sequence using NEBuilder HiFi DNA assembly kit (New England Biolabs) to form the final vector pcDNA5/FRT/TO/3xFLAG-APEX2.
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing libraries were prepared on beads using the Next Ultra II DNA Library Prep Kit for Illumina and Next Multiplex Oligos for Illumina (New England Biolabs) following instructions from the Arima-HiC+ for HiC (Arima Genomics) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10ng of purified DNA (average size 250–300bp) was used to prepare sequencing libraries with the Next Ultra II Library Prep Kit for Illumina (New England Biolabs) using the application note for “Low input ChIP-seq” ...
-
bioRxiv - Microbiology 2023Quote: ... the entire region of pET15b-His-sdeA except for the region encoding 1-199 aa of SdeA was amplified with primers 2649/2712 and then the fragment was self-ligated with a Gibson assembly kit (New England Biolabs). For construction of pmGFP-sdeAΔDUB ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA fragments were generated by PCR amplification and then fused with the backbones using NEBuilder HiFi DNA assembly kit (New England Biolabs). All plasmids were verified by sequencing (GeneWiz).
-
bioRxiv - Cell Biology 2023Quote: ... The sequences were cloned into the pUASz1.0 vector (54) with the eGFP ORF at the C-terminal end of the Top3β ORF using a ligation kit (NEB). The UASz vector allows one to induce the constructs in any tissue ...
-
bioRxiv - Biochemistry 2024Quote: ... The PCR product was purified by phenol chloroform extraction and RNA was synthesized using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). 1 ug of starting linear DNA template was used and transcription was performed for 2hrs at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... or (Q71L for Arf1) and dominant negative (T27N for Arf6) or (T31N for Arf1) by using site-directed mutagenesis (SDM kit from NEB) kit ...
-
bioRxiv - Cell Biology 2024Quote: ... or 3 * 106 cells with the lowest or highest 5% of Spry4:H2B-Venus fluorescence were FAC sorted and their DNA isolated by column-based genomic DNA purification (Monarch Genomic DNA Purification Kit, NEB). For reference ...
-
bioRxiv - Cancer Biology 2024Quote: ... and a final concentration determination was performed using NEBNext® Library Quant Kit for Illumina (New England Biolabs Cat. E7630) prior to library sequencing.
-
bioRxiv - Cell Biology 2024Quote: ... site-directed mutagenesis of the codon encoding lysine at amino acid position 41 was altered to alanine using the Q5 site-directed mutagenesis kit (New England Biolabs) using pPM11 as a template ...
-
bioRxiv - Cancer Biology 2024Quote: ... Purified ChIP DNA was used to prepare Illumina multiplexed sequencing libraries using the NEBNext Ultra II DNA Library Prep kit and the NEBNext Multiplex Oligos for Illumina (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... The 3xFLAG- and HA-tagged ZNRF3 expression vectors were generated with the Q5 Hot Start High-Fidelity DNA Polymerase Kit (New England Biolabs) by replacing the FLAG-tag ...
-
bioRxiv - Cell Biology 2024Quote: ... Poly(A) RNA libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs, #E7770) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 promoter region was added to the 5’ end of each construct for in vitro transcription of RNA using T7 RNA polymerase from T7 HiScribe RNA synthesis kit (New England Biolabs). Synthesized RNA was subjected to DNase treatment (TURBODNase ...
-
bioRxiv - Molecular Biology 2024Quote: ... and sequenced on a NextSeq 2000 instrument (Srp2-HTP & Dbp2-HTP) or with the NEBNext Fast DNA Library Prep Set for Ion Torrent Kit (NEB) and sequenced on an Ion Torrent Proton (Life Technologies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and cloned into the BsaI sites of pSGAb-km and pBECAb-apr using a Golden Gate Assembly Kit (New England Biolabs) to generate pSGAb_ataA and pBECAb_ataA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resulting amplicons were assembled with SalI- and KpnI-cut pSGAb-ataA using the NEBuilder HiFi DNA assembly kit (New England Biolabs) to generate pSGAb-ataA_HR.
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA samples were subjected to DNase I treatment to avoid genomic DNA contamination using a DNase I kit [New England Biolabs (NEB), USA] following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 72mer Ψ-containing model RNA used for mutation analysis and the 1.8-kb 10% Ψ-modified RNA used for UHPLC-MS/MS were prepared by T7 in vitro transcription using HiScribe T7 High Yield RNA Synthesis Kit (NEB) and Pseudo-UTP (Jena Bioscience ...
-
bioRxiv - Molecular Biology 2024Quote: SINV was produced from pT7-SVwt plasmid90 that was first linearized with XhoI and purified to use it as a template for in vitro RNA transcription with HiScribe T7 ARCA mRNA kit (NEB). Transcribed viral RNA was transfected into BHK-21 using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... from HIV-1 infected cells was digested and ligated with linkers using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs) and its associated protocol ...
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... Cells were lysed and total RNA was isolated and purified using the Monarch Total RNA Miniprep Kit (New England BioLabs). This purified RNA was then used to prepare sequencing libraries with the Tru-Seq Stranded with RiboZero Gold (Human/Mouse/Rat ...
-
bioRxiv - Molecular Biology 2024Quote: ... the UGI in pYPQ265E2 was replaced by 2xUGI using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs®) to generate A3A-Y130F-nzCas9-2xUGI ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested by NheI and BamHI were jointed together with 15-20 bp overlapping sequences using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB).
-
bioRxiv - Genomics 2024Quote: ... and the library preparation was conducted using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was performed on the NextSeq500 machine (Illumina) ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was isolated from agar plate-grown seedlings by acid guanidinium thiocyanate-phenol-chloroform-based extraction and purified from the aqueous phase using the Monarch RNA Clean Up Kit (New England Biolabs, Ipswich, MA, USA; NEB). Genomic DNA in the samples was removed using TURBO™ DNase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... each genomic segment was amplified as two PCR products and cloned in the pDIVA backbone (Wetzel et al., 2018) using the NEBuilder HiFi DNA Assembly kit (NEB). The CP-RT ORF (without viral UTRs ...
-
bioRxiv - Neuroscience 2024Quote: ... were generated from a pENTR cyfip2-EGFP plasmid [32] using custom primers and the Q5 Site Directed Mutagenesis Kit (NEB) to induce the desired C179R (ΔRac1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Silent mutations were introduced at the PAM site of the HDR vector by using the Q5 site-directed mutagenesis kit (New England Biolabs). The APEX2-V5-Ten-m HDR and the Ten-m gRNA vectors were co-injected into vas-Cas9124 fly embryos by BestGene ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were used to constructed libraries using NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were generated using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs, #E7645L) according to the manufacturer’s instructions and PCR amplified ...
-
bioRxiv - Immunology 2024Quote: ... Oxford Genomics Centre prepared bulk RNA libraries using an NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced the samples at a depth of 25 million reads per sample on a NovaSeq6000 (Illumina) ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized from 500ng RNA using a Multiscribe High Capacity cDNA Synthesis kit (Thermo) and qPCR was performed using Luna qPCR Master Mix (New England Biolabs) against primers listed in table 2.
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...