Labshake search
Citations for New England Biolabs :
9701 - 9750 of 10000+ citations for Human Complement Component 1 Q Subcomponent Binding Protein HABP1 C1QBP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: RNA-seq libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing libraries were quantified by qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... pLENTI-CMV-GPRC5A was mutated to remove m6A sites (A57G, G120T, C174T, A264G) using Q5 site directed mutagenesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The amplicons were inserted into pMQ123 downstream of the Ptac promoter using the NEBuilder HiFi DNA Assembly kit (New England BioLabs) according to the manufacturer specifications ...
-
bioRxiv - Cancer Biology 2022Quote: ... the fragments were purified and used for adapter ligation and library amplification using the NEBNext Ultra II Fs DNA Library kit for Illumina (NEB # E7805, New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: RNA-Seq Libraries were generated using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB). The RNA-Seq libraries were quantified by Qubit and qPCR according to the Illumina Sequencing Library qPCR Quantification Guide and the quality of the libraries was evaluated on Agilent Bioanalyzer 2100 using the Agilent DNA-1000 chip ...
-
bioRxiv - Molecular Biology 2023Quote: ... mutants of UFD1-His6 (deletion of amino acids 2-215) and NPL4 (T590L+F591V point mutations) 18 were generated using the Q5 Site-Directed Mutagenesis kit (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: PCR amplification was carried out using a Q5® High-Fidelity DNA Polymerase kit (#M0491L, New England Biolabs, Ipswich, MA) using the following protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was obtained by reverse transcription of 0.5 μg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB, #E6560S). Three independent biological replicates were prepared for each genotype ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then the sequencing library was generated by the NEBNext® Ultra II DNA Library Prep Kit (New England Biolabs; E7103S) and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs Index Primers Set 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Next-generation sequencing libraries were prepared using the NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs, cat. no. E7120). Libraries were sequenced using a NovaSeq 6000 device in paired-end sequencing mode 2x150 cycles.
-
bioRxiv - Immunology 2023Quote: ... Polyadenylated transcript enrichment and strand specific library preparation was completed using a NEBNext Ultra II mRNA kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Frozen plant tissue was ground to a powder and RNA was extracted using Monarch ® Total RNA Miniprep kits (NEB), RNA integrity and concentration were assessed by agarose gels and a Nanodrop spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmid pJH114 was used to create the plasmid pJH114-ΔB encoding BamACDE by deleting the bamB gene using the Q5 Site-directed mutagenesis kit (New England Biolabs). The bamA gene ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was submitted to Genome Quebec for library preparation using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs) and 150 bp paired-end shotgun sequencing on an Illumina NovaSeq 6000 platform.
-
bioRxiv - Molecular Biology 2023Quote: ChIP–seq Illumina libraries were generated for immunoprecipitated and input samples using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Sample concentrations were determined using the DeNovix dsDNA Ultra High Sensitivity Kit ...
-
bioRxiv - Genetics 2023Quote: ... The genomic sequence CATGGTATAAAGTGAATCAAGG was targeted by the plasmid pDSP45 which was made from pDD162 (Dickinson et al., 2013) using the Q5 site-directed mutagenesis kit (NEB).
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was pre-amplified with pooled barcoded primers before libraries were prepared with NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs) using the AMPure XP reagent (AgenCourt Bioscience ...
-
bioRxiv - Genomics 2023Quote: ... Short read Illumina sequencing libraries were prepared using the NEBNext Ultra DNA library prep kit for Illumina (New England Biolabs), and sequenced on an Illumina HiSeq 2500 ...
-
bioRxiv - Genetics 2023Quote: ... RT-qPCR was performed on 10 ng total RNA using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005L). bin3 ...
-
bioRxiv - Genetics 2023Quote: ... libraries were generated using total RNA from single and pooled mites (100-600 ng) with the NEBNext Multiplex Small RNA Library Prep kit (NEB) following the manufacturers protocol ...
-
bioRxiv - Genomics 2023Quote: ... Then the enriched mRNA was sheared into short fragments using fragmentation buffer and reversely transcribed into cDNA by Next Ultra RNA Library Prep Kit for Illumina (NEB #7530 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The eluted DNA fragments were then amplified by PCR with Nextera compatible indexed sequencing i5 and i7 adapters using NEBNext 2x PCR Master Mix PCR kit (M0541, NEB). The amplified DNA library was fragment size selected from 200bp to 800bp using Ampure XP beads (A63880 ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... RNA-Seq libraries were then prepared using the NEBNext® Ultra ™ II Directional RNA Library Prep Kit (NEB, E7760) total RNA with rRNA depletion protocol using 100 ng of input RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... we generated CRISPR/Cas9 vectors by mutating the UPRT guide RNA sequence in the plasmid pSag1-Cas9-U6-sgUPRT [33] to a guide RNA sequence of the target gene by using Q5 Site-Directed Mutagenesis Kit (NEB). The CRISPR/Cas9 plasmid and the PCR amplicon were transfected into corresponding parental parasites by using the Lonza Nucleofector and Manufacture suggested protocols ...
-
bioRxiv - Cancer Biology 2023Quote: Libraries were prepared by the Van Andel Institute Genomics Core from an input of 41 ng to 51 ng of ChIP DNA (taken directly from DNA IP’d for siQ-ChIP-seq) using the NEBNext Enzymatic Methyl- seq Kit (New England Biolabs E7120L). The denaturation method used was 0.1 N sodium hydroxide ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-specific mutagenesis of double-stranded plasmid DNAs were constructed using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs), according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... was prepared by in vitro transcription using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs Inc., Massachusetts, USA) with 1 unit RNase Inhibitor (New England Biolabs Inc. ...
-
bioRxiv - Biochemistry 2023Quote: Library preparation was performed with 5 µL of twice poly(A)-enriched sample using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs) according to manufacturer’s instructions for “Protocol for use with Purified mRNA or rRNA Depleted RNA” ...
-
bioRxiv - Developmental Biology 2023Quote: ... MYC) were made in-house by in vitro transcription using mRNA synthesis with HiScribeTM T7 ARCA mRNA Kit (NEB E2060S) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coding exons of Gdf1/3 were individually amplified from genomic DNA templates and then assembled into the pXT7 vector using a Gibson cloning kit (New England Biolabs). Nodal ...
-
bioRxiv - Biochemistry 2023Quote: ... A TEV protease cut site preceding the 6x histidine tag was previously introduced using the Q5 Site-Directed Mutagenesis Kit from NEB and the GeneJET Plasmid Miniprep Kit from ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... enough to cover the whole genome (https://artic.network/ncov-2019) and the Q5 TaqPolymerase kit (New England Biolabs, Massachusetts, USA), as previously described [10] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of purified DNA was then used for library preparation with NEB Next Ultra Library Preparation Kit (New England Biolabs), using five PCR cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries for small DNA fragments (25-75 bp) were prepared with NEBNext Ultra II DNA library prep Kit (NEB#E7645).
-
bioRxiv - Neuroscience 2023Quote: ... and used as the template to insert the Glu-Glu epitope sequence (EYMPME) and the GPR37L1 variants used in the experiments by in vitro mutagenesis using Q5 Site-Directed Mutagenesis Kit (BioLabs). cDNA clones were confirmed by Sanger DNA sequencing (GeneWiz) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Second-strand DNA synthesis was done by ligating 10 µM of a blunt-end duplex comprised of a 32-bp Illumina R1-3’SpC3 and 5’-phosphorylated R1R-3’SpC3 DNA (pre-annealed by incubating at 95°C for 3 min and slowly cooling to 25°C) using a Quick ligase kit (New England Biolabs) according to manufacturer’s protocol followed by clean-up as described above ...
-
bioRxiv - Microbiology 2023Quote: The cellular mRNA from THP-1 cells was reverse transcribed with oligo-dT primer through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs) after TRIzol (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... The plasmid encoding ABE8e was modified to incorporate mutations in the adenine deaminase domain (V28R or R111S) using a Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... In vitro Cas9 incubation was performed to enrich the nanopore library for regions of interest using EnGen sgRNA synthesis kit (NEB) and Cas9 nuclease (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA from the whole nuclei or nuclear condensate fractions were extracted using genomic DNA extraction kit (New England Biolabs). DNA-seq library was prepared from 50 ng of extracted genomic DNA using Illumina Nextera DNA Library Prep kit ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were generated using NEBNext® Ultra™ II Directional (stranded) RNA Library Prep Kit for Illumina (NEB #E7760L). Ribosomal RNA was removed using NEBNext rRNA Depletion Kit (human ...
-
bioRxiv - Immunology 2023Quote: ... were purified using the QIAquick PCR purification kit and ligated into the appropriate linearized expression vectors using T4 DNA ligase (New England BioLabs) and incubated overnight at 16°C.
-
bioRxiv - Microbiology 2023Quote: Epitope-tagged constructs using the GST tag or the 3X FLAG tag were generated using the HiFi DNA Assembly cloning kit (NEB). MntS was cloned into pGEX-6-1 and the GST-MntS fusion was subcloned into pKT25c such that the resulting plasmid lacked the T25 region ...
-
bioRxiv - Microbiology 2023Quote: The ΔmntP::mneA replacement strain was generated by cloning the KanR cassette from pKD4 next to the mneA gene in pJS4B using the HiFi DNA Assembly cloning kit (NEB) (41) ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Genomics 2023Quote: Small RNA libraries were prepared using the NEBnext small RNA library kit for Illumina (New England Biolabs, Cat. No E7330S), following the standard protocol with the following parameters ...
-
bioRxiv - Microbiology 2023Quote: ... DNA libraries were prepared from extracted gDNA using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB). DNA was purified and size selected using Ampure XP beads (Beckman Coulter ...