Labshake search
Citations for New England Biolabs :
9651 - 9700 of 10000+ citations for Human Complement Component 1 Q Subcomponent Binding Protein HABP1 C1QBP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared with 2 ng of input or IP DNA using the NEBNext Ultra II DNA Library kit for Illumina (New England Biolabs). The quality of the libraries was assessed using the High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Synthetic Biology 2023Quote: All plasmids used in this study were constructed by Golden Gate cloning using the EMMA cloning platform35 or NEBridge Golden Gate Assembly BsaI-HFv2 and BsmBI-v2 kits (NEB) and are listed in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sequence encoding C-KSR was subcloned into pETM11-SUMO3 via Gibson assembly using Gibson Assembly Cloning Kit (NEB, USA). Sequences encoding N-KSR or C-KSR were subcloned into SfiI sites of pSBbi-pur-H-2Kb (# 111623 ...
-
bioRxiv - Cell Biology 2023Quote: ... was fragmented using a Covaris E220 sonicator and used for metagenomic library preparation using the NEBNext Ultra II DNA Library Prep kit for Illumina (New England BioLabs), with the target insert length of 350 bp ...
-
bioRxiv - Genetics 2023Quote: ... The Bh2(Bh1/547-575) chimeric allele was generated using the Q5® Site-Directed Mutagenesis kit (NEB, Ipswich MA) using oligos osd126 and osd127 and p1-BH2 plasmid DNA as template ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Sequencing libraries were prepared with the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA), targeting the insert size of 250 bp ...
-
bioRxiv - Developmental Biology 2023Quote: ... The fragments were cloned into a pCS2+ plasmid linearized with Xho1 and Xba1 restriction enzymes using a Quick Ligation Kit (NEB). Each plasmid was then linearized with NotI restriction enzyme and mRNAs were synthesized by in vitro transcription (using the mMESSAGE mMACHINE sp6 Ultra kit AM1340 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... RNAseq libraries were prepared using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs E7760S) with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Genetics 2023Quote: ... Dual-indexed sequencing libraries were made using the NEBNext Ultra II DNA Library Prep Kit for Illumina (E7645S, New England Biolabs) or CUTANA™ CUT&RUN Library Prep Kit with Primer Set 1 (14-1001 ...
-
bioRxiv - Genetics 2023Quote: Libraries for 12 samples (Table S1) were prepared using the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs, Massachusetts, USA) following the manufacturer’s large insert libraries protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 5-10 ng of input RNA was used to produce libraries with the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB) which were sequenced on an Illumina HiSeq 3000 to produce 50 bp single-end reads ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription and quantitative real-time PCR was performed using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in a 96-well plate and qPCR was performed in a LightCycler 96 System (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: The donor plasmid pBS-Eno-Mutpi was generated by assembly of PCR fragments into pBS-SK+ digested by EcoRI and KpnI using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB) and primers designed for amplifying ≈1 kb long homology arms from w1118 genomic sequence ...
-
bioRxiv - Genetics 2023Quote: ... Single-stranded RNA was synthesized from the PCR product using Hiscribe T7 Quick High Yield RNA Synthesis Kit (E2050S, NEB). The ssRNA was then converted into ssDNA using Maxima H Minus Reverse Transcriptase (EP0753 ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids were generated by PCR amplification of open reading frames (ORFs) in cDNA and ligation into a linearized pHAGEb vector using a Gibson assembly kit (New England Biolabs). dH5a or Stable competent E ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Final eluates were used as input for strand-specific RNA-seq library construction using the NEBNext RNA Library Prep Kit (New England Biolabs). Libraries were fractionated on 4% agarose E-gels (Invitrogen) ...
-
bioRxiv - Genomics 2023Quote: ... DNA extraction from the blood samples was performed using the Monarch HMW DNA Extraction Kit for Cells & Blood (NEB, T3050) following the manufacturer’s protocol (New England Biolabs ...
-
bioRxiv - Genetics 2023Quote: ... The library preparation was done using an NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The libraries were sequenced on the NextSeq500 instrument (Illumina) ...
-
bioRxiv - Plant Biology 2023Quote: ... Chemical fragmentation of ligated RNA to ≤200nt was performed using the Magnesium RNA fragmentation kit (New England Biolabs, cat#E6150S). 2ul RNA Fragmentation Buffer was added and samples were incubated at 94°C for 5 minutes followed by a transfer to ice and the addition of 2μl of RNA Stop solution ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA-sequencing libraries were prepared from 500 ng total RNA using the Ultra II directional RNA library preparation kit (NEB) in combination with the NEBNext Poly(A ...
-
bioRxiv - Microbiology 2023Quote: ... GPRC5A-FLAG and GPRC5A expressing plasmids were generated by PCR of the entire coding sequence of GPRC5A from TREx BCBL1-Rta cDNA and cloning using NEBuilder HIFI DNA assembly kit (NEB) into pLENTI-CMV-GFP-PURO ...
-
bioRxiv - Neuroscience 2023Quote: ... and cDNA was prepared with Protoscript II first-strand cDNA synthesis kit as per manufacturer’s protocol (New England Biolabs, USA). The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a knockout construct was assembled into the suicide plasmid vector pZDJ 78 with either the Gibson Assembly Cloning Kit or the NEBuilder HiFi DNA Assembly Master Mix (both New England Biolabs). The antibiotic resistance cassette flanked by flippase recognition target (FRT ...
-
bioRxiv - Genomics 2022Quote: ... DNA was ultrasonicated to a fragment size of 270 bp and the library was prepared using an Ultra DNA Library Prep Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The V7 variant of AR was generated from peGFP-C1-AR using the Q5 site-directed mutagenesis kit and primer design tools (New England BioLabs) with the following primer pair:
-
bioRxiv - Developmental Biology 2022Quote: ... Deletions within the nhr-23 3′ UTR reporter (cloned in pHR017) were created using a Q5 Site-Directed Mutagenesis Kit (NEB) and verified by Sanger Sequencing (Genewiz Inc.) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the eluted DNA was used to make sequencing libraries using the NEBNext Ultra or Ultra II DNA Library Prep Kit for Illumina (NEB) with NEBNext Multiplex dual index primers with 12 amplification cycles and 2 additional AMPure XP clean-up steps at 0.8X ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteinase K was inactivated (20 min 82 °C) and the crRNA target site was amplified with One Taq Hot Start DNA polymerase kit (NEB), followed by Sanger sequencing (primers in Table S3) ...
-
bioRxiv - Cell Biology 2023Quote: ... Library quality was confirmed using an Agilent BioAnalyzer 2100 and quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs). Sequencing was performed using the Illumina NextSeq500 platform employing a single-end ...
-
bioRxiv - Microbiology 2023Quote: ... Transcription and fluorescent labelling of RNA in vitro transcription reactions were carried out using a T7 RNA transcription kit (HiScribe T7 High Yield; New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and p.2.5’ genomic RNA was generated by in vitro transcription using the HiScribe™T7 ARCA mRNA kit (New England Biolabs). For ZIKV-WT ...
-
bioRxiv - Cell Biology 2023Quote: ... and library prep performed on the beads using the NEBNext Ultra II DNA library prep kit for Illumina (NEB, E7645L), according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and the extracted RNA was reverse transcribed using LunaScript® RT SuperMix Kit (Cat. NEB #E3010; New England Biolabs, MA). The feline IFNγ mRNA were evaluated using primers (5’AATACCAGCTCCAGTAAACGG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... and the extracted RNA was reverse transcribed using LunaScript® RT SuperMix Kit (Cat. NEB #E3010; New England Biolabs, MA). The feline IFNγ mRNA were evaluated using primers (5’AATACCAGCTCCAGTAAACGG 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription was performed on 500 ng of total RNA using a LunaScript™ RT SuperMix Kit (New England Biolabs) as according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR for SARS-CoV-2 from cell lysates was performed using the TaqMan assay for the CDC N1 gene primers and probes from Integrated DNA Technologies (catalog no. 10006600; Integrated DNA Technologies) using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) as previously described (6) ...
-
bioRxiv - Microbiology 2023Quote: In vitro transcription reactions were carried out using a T7 RNA transcription kit (HiScribe T7 High Yield; New England Biolabs) with the following modifications ...
-
bioRxiv - Immunology 2022Quote: ... capture and RNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... performed to exchange the previous gRNA sequence was achieved using a Q5 mutagenesis kit (New England Biolabs, Ipswich, Massachusetts, USA). gRNA sequences were inserted into pTREX-n-Cas9 using primers specific to the gene of interest in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2023Quote: ... PYD and HD mutants were generated from full length IFI207-HA plasmids and the R1-PYD mutant from R1-IFI207 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). IFI207-HIN plasmids were generated by PCR amplification of the HIN domain from full length IFI207-V5 expression plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... pDS01 and pDS02 were constructed by restriction digestion with BamHI and SbfI followed by ligation with a Quick Ligation Kit (NEB). All other plasmids were constructed using a HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA samples were then subjected to qRT-PCR of BB0838 and flaB transcripts using the Luna Universal One-Step RT-qPCR kit (NEB) and an ABI Prism 7500 system (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... Cloning was performed by assembling the purified PCR fragments into the specified pET derivative expression vector using the commercially available NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... A stop codon was inserted after amino acid residue 370 by site directed mutagenesis using Q5 Site-Directed Mutagenesis Kit (NEB), in order to express the truncated N1-370 construct ...
-
bioRxiv - Genomics 2023Quote: ... 170-200 ng of library was indexed using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). The manufacturer’s protocol was followed with the following deviations ...
-
bioRxiv - Genetics 2023Quote: ... Genomic DNA from single adult male flies was extracted using using the Monarch Genomic DNA Purification Kit (New England Biolabs), using a protocol we developed (dx.doi.org/10.17504/protocols.io.bp2l694qklqe/ v1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 500ng of total RNA were used for RNA-Seq library preparation with the NEBNext Ultra II RNA Library Prep Illumina Kit (NEB) and sequenced with the NextSeq 500/550 sequencing platform (performed at the NYUAD Sequencing Center within the NYUAD Core Technology Platform) ...
-
bioRxiv - Plant Biology 2022Quote: ... Libraries were then generated using 10 ng of DNA and NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng RNA was used for library preparation using NEBNext Ultra II Directional RNA Library Prep kit (NEW ENGLAND BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... the C-terminus of the Apoptin encoding plasmid was removed and replaced with the Mxe-GyraseA Intein using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs). Sanger sequencing of resulting plasmids was carried out by GENEWIZ.