Labshake search
Citations for New England Biolabs :
851 - 900 of 7751 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Genetics 2021Quote: ... 2nd cDNA strand was again synthesized using a transcript specific primer (either 5’UTR_βG-intron _F or 5’UTR_CMV _F2, Table 4) and Q5 2x master mix (NEB, #M0494). After another round of bead purification ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 and 6 and then assembled into pASW vector by NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Immunology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). The Hifi assembly products were Ampure bead purified and eluted into 20 µL of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour HiFi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). HiFi assembly products were Ampure bead purified and eluted into 20uL of H2O for higher electroporation efficiency.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL of linker ligation mixture was added (38% PEG-8000, 1x NEB T4 ligase buffer, 2 µM oBZ407_preA preadenylated linker, 100 units NEB T4 RNA ligase 2, truncated) and they were further incubated at 37 °C for 3 hrs ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Microbiology 2020Quote: ... then quenched with 2 μL 6X purple loading dye (NEB) at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µL of 10x uracil DNA glycosylase buffer (NEB M0280S), 2.5 µL RNase A (M0280S ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 units of 2’-O-Me-transferase (New England Biolabs) and 25 units RNasin Plus RNase inhibitor (Promega) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 200 U/uL of T4 RNA Ligase 2 (NEB M0351S), 1X T4 RNA Ligase Reaction Buffer (NEB B0216L) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 uL of 10X T4 RNA ligation buffer (NEB B0216L), 2 uL of 10mM ATP ...
-
bioRxiv - Developmental Biology 2020Quote: ... a mix containing 2 μl of RNAse H (NEB, #M0297S), 1 μl of E ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of NEB buffer 3.1(1X, New England Biolabs) and 1 μL of each DNA barcode B and ligation linker mix (B1-B50 ...
-
bioRxiv - Microbiology 2022Quote: ... PEG 8000 (17.5% final) and T4 RNA ligase 2 (NEB) in 1x T4 RNA ligase buffer at 25°C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.5 units/µl T4 RNA Ligase 2 (NEB, M0239S), with the enzyme added after the other components had been mixed and incubated at 23°C for 5 min ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of NEB DNA Quick Ligase (New England Biolabs) and 3 μL of Illumina Indexed adapter were added to the beads and incubated for 15 minutes at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... 12.5 µL NEBNext High-Fidelity 2× PCR Master Mix (NEB) were added and samples were PCR-amplified (72 °C 5 min ...
-
bioRxiv - Genomics 2020Quote: ... 12.5 μL NEBNext High-Fidelity 2× PCR Master Mix (NEB) were added and samples were PCR-amplified (72 °C 5 min ...
-
bioRxiv - Genetics 2019Quote: ... 2 μl of 20 mg/ml proteinase K (NEB, P8107S) was added ...
-
bioRxiv - Microbiology 2019Quote: ... All cloning was performed with Q5 2× master mix (NEB) unless otherwise noted ...
-
bioRxiv - Neuroscience 2019Quote: ... alongside a 2-log DNA ladder (New England BioLabs Inc.). All primers sequence can be in Supplementary Table 1.
-
bioRxiv - Genomics 2020Quote: ... 2× LongAmp Taq Master Mix (25 μl; New England Biolabs) was used to synthesize second-strand cDNA using 2 μl of the PR2 primer (ONT) ...
-
bioRxiv - Genomics 2021Quote: ... 12.5 µL NEBNext High-Fidelity 2× PCR Master Mix (NEB) were added and samples were PCR-amplified (72 °C 5 min ...
-
bioRxiv - Genomics 2021Quote: ... 12.5 µL NEBNext High-Fidelity 2× PCR Master Mix (NEB) were added to each well and samples were PCR-amplified (72 °C 5 min ...
-
bioRxiv - Microbiology 2021Quote: F(ab’)2 fragments were generated using IdeZ protease (NEB), purified using CaptureSelect LC-lambda affinity matrix (human ...
-
bioRxiv - Neuroscience 2020Quote: ... 12.5 µL NEBNext High-Fidelity 2× PCR Master Mix (NEB) were added and samples were PCR-amplified (72 °C 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... 2 U of HindIII (New England Biolabs, Beverly, MA, USA), 2 U of EcoRI (New England Biolabs ...
-
bioRxiv - Systems Biology 2021Quote: ... PCR amplicons were purified from a 2% agarose gel (NEB), digested with EcoRI-HF and NotI-HF (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... diluted 2-fold in 1x G3 buffer (New England Biolabs) and incubated with 160 U endoglycosidase H (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2 μL T4 DNA Polymerase (#M0203S, New England Biolabs). The reaction was incubated at room temperature for 45 min with gentle mixing every 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µl of 20 µM SpCas9 (NEB, Cat. No. M0646M) was placed in the bottom of a 0.25 ml PCR tube ...
-
bioRxiv - Neuroscience 2020Quote: ... 12.5 μL NEBNext High-Fidelity 2× PCR Master Mix (NEB) were added and samples were PCR-amplified (72 °C 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysates were flowed over 2 mL amylose resin (NEB) equilibrated with MBP lysis buffer to capture MBP-tagged protein ...
-
bioRxiv - Molecular Biology 2022Quote: ... α2-3,6,8 neuraminidase (New England Biolabs, 25 U/μg protein) and α-N-acetyl-galactosaminidase (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 µl of T4 DNA Ligase Buffer (New England Biolabs), 1 µl of T4 or T7 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 µl of T4 DNA Ligase Buffer (New England Biolabs), 1 µl of T4 or T7 DNA Ligase (New England Biolabs ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μL (1000 U) PNGase F (New England Biolabs Inc) were added and the reaction was incubated for 6 h at 37 °C ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 µM of SNAP-Surface Alexa Fluor 647 (NEB) in extracellular buffer for 30 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 100 units of 2′-O-Me-transferase (New England Biolabs) and 25 units RNasin Plus RNase inhibitor (Promega) ...