Labshake search
Citations for New England Biolabs :
801 - 850 of 7751 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... SNAP-Cell TMR Star (2 mM in DMSO, NEB), and SNAP-Cell Block (2 mM in DMSO ...
-
bioRxiv - Biochemistry 2023Quote: ... and SNAP-Cell Block (2 mM in DMSO, NEB) were prepared and stored as aliquots in the dark at –20 °C ...
-
bioRxiv - Genomics 2023Quote: ... and digested with 2 units of β-agarase (NEB) (42°C ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µL of PNGase F (New England Biolabs, MA) was added ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 μL of 10x Standard Taq Reaction Buffer (NEB), 0.4 μL of dNTPs (2.5 μM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 units of DNase I (New England Biolabs, M0303S) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µl PNGaseF (P0705L, Glycerol-free, New England Biolabs) was added and incubated for one hour at 57⁰C ...
-
bioRxiv - Bioengineering 2023Quote: ... and mRNA Cap 2’-O-methyltransferase (NEB, catalog #M0366S). We then added a 3′-poly(A ...
-
bioRxiv - Microbiology 2024Quote: ... 200 U T4 RNA ligase 2 truncated KQ (NEB), 1x T4 RNA ligase buffer (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 2 mg/mL temperature labile proteinase K (NEB, P8111S), and 12.5 mM MgCl2 for RNA fragmentation) ...
-
bioRxiv - Biochemistry 2024Quote: ... using Q5® High-Fidelity 2× Master Mix (NEB) and 200 nM of each primer ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µL 10× T4 RNA Ligase Reaction Buffer (NEB), 6 µL PEG8000 (50%) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 2 µl of DNase I (2500U/mL, NEB) for each mL of B-PER reagent used ...
-
bioRxiv - Cancer Biology 2024Quote: ... 25 µl NEBNext HiFi 2× PCR Master mix (NEB) was immediately added and mixed before proceeding to PCR cycles (58 °C for 5 min (gap filling) ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was converted using the Enzymatic Methyl-seq conversion module (NEB) following manufacturer’s instructions with slight modifications ...
-
bioRxiv - Genomics 2024Quote: ... teleta were assayed by Enzymatic-Methyl seq (EM-seq) (NEB #E7120) according to the manufacturer-provided protocol ...
-
bioRxiv - Genomics 2024Quote: ... Libraries were constructed using the NEBNext Enzymatic Methyl-seq Kit (NEB), following the manufacturer’s guidance ...
-
bioRxiv - Cancer Biology 2024Quote: ... NEB Next Enzymatic Methyl-seq (EM-seq, New England Biolabs, #E7120S) was used to identify 5-methylcytosine and 5-hydroxymethylcytosine bases and sequencing libraries were constructed by NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Genomics 2019Quote: ... expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1) expressing ATG7 isoform 1 was derived from pCMV-myc-Atg7(2) using the Q5 site-directed mutagenesis kit (NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Genomics 2019Quote: ... The mixture was supplemented with 5 µL DNA polymerase (3 U/µL, NEB) and 6 µL Klenow (5 U/µL ...
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and A-tailed using Klenow 3’-5’exo-enzyme (NEB, Cat. No. M0212). Illumina sequencing library adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Cell Biology 2023Quote: ... which were then degraded by the 5’-3’ ssDNA exonuclease RecJ (NEB, M0264S). After rRNA reduction using the riboPOOL rRNA depletion kit (siTOOLs Biotech ...
-
bioRxiv - Genomics 2023Quote: ... and A-tailed with Klenow Fragment (3’-to-5’ exo-, New Englands Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 ng of PCR product of RFLP_region 1 and RFLP_region 2 were digested with PstI (New England Biolabs) and VspI (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... at 30°C for 1 hour in a total volume of 50μl PMP phosphatase buffer (50 mM HEPES pH 7.5, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, 1 mM MnCl2; New England Biolabs).
-
bioRxiv - Biochemistry 2020Quote: ... by incubating the cells with 2 μM ATTO594-Coenzyme A and 1 μM phosphopantetheine transferase (New England Biolabs) in Ham’s F12 medium without FBS at ~25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... A 32P radiolabelled Y’ PCR fragment (oligo sequences in Supplementary Table 1) or 2-log ladder (NEB N3200L) was added at 106 counts/ml of Y’ and 104 counts/ml of 2-log ladder and hybridized overnight ...
-
bioRxiv - Microbiology 2022Quote: ... region between MCS-1/MCS-2 and linearized pETDuet plasmid were ligated using the Gibson Assembly® (NEB) to generate the pETDuet pe15/ppe20 plasmid ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and assembled into the backbone vector at a 2:1 molar ratio via Golden Gate Assembly81 (NEB #R3733). The assembly mix was then transformed into electrocompetent DH10B E ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µL of each reaction was combined with 2 µL of 6X Purple Gel Loading Dye (NEB B7024S) and 11 µL H2O and run on a 1.2% agarose gel containing 1X GelGreen Nucleic Acid Stain (Biotium 41005 ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μl of methylation-sensitive restriction enzyme DpnI and 2 μl CutSmart® buffer (both from NEB inc.) were added to the assembled reaction and incubated at 37 °C for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: We then set up the digestion reaction (1.5 μg of pX459, 2 μL of 10X NEBuffer 2.1, 1 μL of BbsI (NEB), and added H2O to a final volume of 20 μL) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM NaCl, 2 mM EDTA, 1% NP40, 0.1%SDS, 0.5 mM DTT, 40 U RNase inhibitor [New England Biolabs, cat#M0314L] ...
-
bioRxiv - Bioengineering 2024Quote: ... DNA fragments encoding CDRs 1 and 2 were digested overnight with BsaI-HFv2 and BbsI-HFv2 respectively (NEB). Reactions were cleaned up with Macherey Nagel Gel cleanup columns ...
-
bioRxiv - Genomics 2021Quote: ... 5 μl of 100 ng/μl cDNA diluted from the previous step was combined with 2 μl block mix and 2 μl nuclease free water (NEB, catalog no. AM9937), then the cDNA-block oligo mix was incubated on a thermocycler under the following condition to allow block oligo mix to bind to 5’ and 3’ end of the cDNA molecule ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... was prepared by combining 2 µL of 100 µM guide RNA (gRNA) with 2 µL of 20 µM EnGen SpyCas9 NLS (NEB, Cat. No. M0646T), and incubated at room temperature for 2-4 hours ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 mM EDTA) + 4 μl of Proteinase K (20 mg/ml, NEB) at 55°C (300 rpm continuous shaking in a thermomixer) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Bioengineering 2024Quote: ... This strategy avoids 3’-terminal editing of the mismatched primers by the 3’-5’ exonuclease activity of Q5® High-Fidelity DNA Polymerase (NEB), increasing PCR specificity.61
-
bioRxiv - Molecular Biology 2024Quote: ... was used to repair the sonicated DNA and successively 3’ A-tails were added by Klenow Fragment (3’→5’ exo-) (NEB, M0212S) and dATPs (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...