Labshake search
Citations for New England Biolabs :
1101 - 1150 of 7751 citations for 6 methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: RNA 5’-ends were phosphorylated using 4 µl T4 PNK (NEB, catalog no. M0201) in a solution consisting of 8 µl 10x PNK buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... activation was performed overnight at 4 °C with 5 μg of Factor Xa (NEB) per mg of protein ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Bioengineering 2019Quote: ... with 3, 6, or 12 nM iSpinach DNA (IDT, USA, Ultramers) template in transcription buffer (1x RNAPol Reaction Buffer (NEB, No ...
-
bioRxiv - Microbiology 2021Quote: ... 4°C and the supernatant applied on a 6 ml gravity flow column with Chitin resin (New England Biolabs), equilibrated with 20 mM HEPES ...
-
bioRxiv - Molecular Biology 2021Quote: ... All these reactions were performed in a single step by adding 2 µL of enzyme mix (1 µL of Thermolabile USER II (New England Biolabs, M5508L), 0.5 µL of Exonuclease I (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated with 100 μl CutSmart buffer containing 5 mM DTT and 1 mM dATP for 1 hour at room temperature before incubation for 2 h at 37°C in another 100 μl of the same buffer containing 1 μl Klenow exo-(NEB M0212S) and 1 μl T4 PNK (NEB M0201S) ...
-
bioRxiv - Zoology 2021Quote: ... amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log, 100 bp, or 1 kb DNA ladder from New England Biolabs, USA). Expected PCR product sizes of the first step and nested PCR step were 514 and 148 bp ...
-
bioRxiv - Synthetic Biology 2022Quote: Templates for expression of MGVDYKDDDDK were prepared by annealing and extending the oligonucleotides MGVflag-1 and MGVflag-2 using Q5® High-Fidelity 2X Master Mix (NEB) (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Master mix was added to each sample together with 1 µl truncated T4 RNA Ligase 2 (#M0239, NEB; Frankfurt/Main, Germany). Ligation was carried out for 2 h at 23°C and nucleic acids were precipitated ...
-
bioRxiv - Biochemistry 2020Quote: cDNA was reverse-transcribed from donor 1 and donor 2 RNA samples using the ProtoScript II first strand cDNA synthesis kit (NEB #E6560) with oligo dT priming ...
-
bioRxiv - Pathology 2019Quote: ... protocol using the PCR Barcoding Expansion 1-12 (EXP-PBC001) kit (ONT) and LongAmp Taq 2× Master Mix (New England Biolabs, MA) with the following thermocycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... was linerized by inverse PCR with primers 13 and 14 and the duplex oligo was ligated to the linearized plasmid in a 2:1 insert:vector molar ratio using NEBuilder Hifi Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 and 2) and NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). Library quantification was performed by real-time PCR using the KAPA Library Quantification Kit - Illumina Platforms - Complete kit (Universal ...
-
bioRxiv - Genomics 2021Quote: ... PCR amplification of the samples was performed using Nextera primers 1 and 2 and NEBNext High fidelity master mix (NEB, M0541S) for 12 cycles as determined by KAPA Real-Time Library Amplification Kit (Peqlab ...
-
bioRxiv - Microbiology 2024Quote: ... were digested with NotI and the wc-1 and wc-2 fragments were cloned into the respective plasmids with NEB HiFi DNA assembly mastermix (NEB, US). This resulted in the prey plasmid wc-1-pMB29 and bait plasmid wc-2-pMB28 ...
-
bioRxiv - Biochemistry 2024Quote: ... 125 μg of λ-phage DNA was mixed with two oligos (2 μM oligo Lab07 (/5Phos/AGG TCG CCG CCC/3BioTEG) and 2 μM oligo Lab06 (/5Phos/GGG CGG CGA CCT/3BioTEG) in 1× T4 DNA ligase reaction buffer (NEB B0202S) and heated to 70°C for 15 min followed by gradual cooling to 15°C for 2 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... was combined with either MEP-1 or Mi-2 PCR-amplified coding sequences in a Gibson assembly reaction using NEBuilder® HiFi DNA Assembly kit (NEB) following manufacturers protocols ...
-
bioRxiv - Genetics 2023Quote: ... Index primers set 1 and 2 from the NEBNext Multiplex Oligos for Illumina kit (New England Biolabs, E7335S/L E7500S/L) were incorporated using Herculase II Fusion Polymerase Kit (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: One-cell stage zebrafish embryos were injected with 1-2 nl of injection solution containing 300 ng/μl of Cas9 enzyme (NEB# M0646T) and 12.5 ng//μl of sgRNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5XSSC in H2O) on a light table for 1 hour and treated with 2 μg/mL Protease K (NEB, Cat PB107S) in PBS containing 0.3% Triton-X for 10 minutes followed by post-fixation in 4% PFA for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Assembly reaction was performed at 1:2 vector: insert ratio using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs #E5520) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... A total of 25 μg was then diluted to 100 μL with CP-1 buffer with or without 2 μg/mL proteinase K (New England Biolabs P8107S) and the indicated concentration of digitonin or 2% Triton ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 1 μl 5′ deadenylase (New England Biolabs) and 1 μl RNaseOUT ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL MgSO4 (4 mM; Biolabs, Ipswich, MA), 1.4 μL dNTPs (1.4 mM ...
-
bioRxiv - Plant Biology 2022Quote: ... The samples were converted for sequencing with the NEBNext enzymatic methyl-seq kit (NEB) and sequenced at the University of Minnesota Genomics Center ...
-
bioRxiv - Molecular Biology 2024Quote: ... End prep and adaptor ligation was performed using the Enzymatic Methyl-seq kit (NEB). Conversion was performed identically to the amplicons ...
-
bioRxiv - Genomics 2023Quote: ... We used the NEB Next Enzymatic Methyl-seq Kit (New England Biolabs Cat.no. E7120S). Control DNA (CpG methylated pUC19 and unmethylated lambda ...
-
bioRxiv - Genetics 2023Quote: ... digested DNA was converted using New England Biolabs’ Enzymatic Methyl-seq Kit (E7120S, NEB) to detect selectively oxidized unmethylated cytosines ...
-
bioRxiv - Developmental Biology 2020Quote: ... Approximately 1kb 5’ and 3’ Homology arms were assembled using HiFi DNA Assembly (New England Biolabs) upstream and downstream of this cassette with the following primers (5’-3’):
-
bioRxiv - Developmental Biology 2020Quote: ... DNA fragments were end-repaired and A-Tailed using Klenow fragment (3’-5-exo-) (NEB, M0212L), the DNA fragments were ligated to illumina adaptors (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... Singlet and duplet pools were A-tailed using using Klenow HC 3’→5’ exo- (#M0212L; NEB).
-
bioRxiv - Biophysics 2022Quote: ... The gene sequences were flanked by restriction enzyme sites for 5’ NdeI and 3’ EcoRI (NEB). Genes were cloned into pET21a using standard protocols from NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ and 3’ homology arms and the insert were cloned into the pUC19 vector (NEB, #N3041S) by using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by dA tailing with 0.25 U/µL Klenow (3′→5′ exo-) (New England Biolabs, M0212) in the presence of 0.5 mM dATP (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was 5’-labelled with 20 U of T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB # M0236S) and 50 pmol of (gamma-32P)ATP (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Genomics 2019Quote: ... For that the mix containing 2 µL of RNAse H (NEB, #M0297S), 1 µL of E ...
-
bioRxiv - Biochemistry 2019Quote: ... 400ng of library was amplified for 2 rounds using standard Phusion (NEB) PCR conditions ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was then passed over a 2 mL amylose column (NEB) and washed with 3 CV of Flag Wash Buffer ...