Labshake search
Citations for New England Biolabs :
8901 - 8950 of 10000+ citations for Human Oxidized low density lipoprotein receptor 1 OLR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... was prepared by in vitro transcription using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs Inc., Massachusetts, USA) with 1 unit RNase Inhibitor (New England Biolabs Inc. ...
-
bioRxiv - Biochemistry 2023Quote: Library preparation was performed with 5 µL of twice poly(A)-enriched sample using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs) according to manufacturer’s instructions for “Protocol for use with Purified mRNA or rRNA Depleted RNA” ...
-
bioRxiv - Developmental Biology 2023Quote: ... MYC) were made in-house by in vitro transcription using mRNA synthesis with HiScribeTM T7 ARCA mRNA Kit (NEB E2060S) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coding exons of Gdf1/3 were individually amplified from genomic DNA templates and then assembled into the pXT7 vector using a Gibson cloning kit (New England Biolabs). Nodal ...
-
bioRxiv - Biochemistry 2023Quote: ... A TEV protease cut site preceding the 6x histidine tag was previously introduced using the Q5 Site-Directed Mutagenesis Kit from NEB and the GeneJET Plasmid Miniprep Kit from ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... enough to cover the whole genome (https://artic.network/ncov-2019) and the Q5 TaqPolymerase kit (New England Biolabs, Massachusetts, USA), as previously described [10] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of purified DNA was then used for library preparation with NEB Next Ultra Library Preparation Kit (New England Biolabs), using five PCR cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries for small DNA fragments (25-75 bp) were prepared with NEBNext Ultra II DNA library prep Kit (NEB#E7645).
-
bioRxiv - Neuroscience 2023Quote: ... and used as the template to insert the Glu-Glu epitope sequence (EYMPME) and the GPR37L1 variants used in the experiments by in vitro mutagenesis using Q5 Site-Directed Mutagenesis Kit (BioLabs). cDNA clones were confirmed by Sanger DNA sequencing (GeneWiz) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Second-strand DNA synthesis was done by ligating 10 µM of a blunt-end duplex comprised of a 32-bp Illumina R1-3’SpC3 and 5’-phosphorylated R1R-3’SpC3 DNA (pre-annealed by incubating at 95°C for 3 min and slowly cooling to 25°C) using a Quick ligase kit (New England Biolabs) according to manufacturer’s protocol followed by clean-up as described above ...
-
bioRxiv - Microbiology 2023Quote: The cellular mRNA from THP-1 cells was reverse transcribed with oligo-dT primer through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs) after TRIzol (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... The plasmid encoding ABE8e was modified to incorporate mutations in the adenine deaminase domain (V28R or R111S) using a Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... In vitro Cas9 incubation was performed to enrich the nanopore library for regions of interest using EnGen sgRNA synthesis kit (NEB) and Cas9 nuclease (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA from the whole nuclei or nuclear condensate fractions were extracted using genomic DNA extraction kit (New England Biolabs). DNA-seq library was prepared from 50 ng of extracted genomic DNA using Illumina Nextera DNA Library Prep kit ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were generated using NEBNext® Ultra™ II Directional (stranded) RNA Library Prep Kit for Illumina (NEB #E7760L). Ribosomal RNA was removed using NEBNext rRNA Depletion Kit (human ...
-
bioRxiv - Immunology 2023Quote: ... were purified using the QIAquick PCR purification kit and ligated into the appropriate linearized expression vectors using T4 DNA ligase (New England BioLabs) and incubated overnight at 16°C.
-
bioRxiv - Microbiology 2023Quote: Epitope-tagged constructs using the GST tag or the 3X FLAG tag were generated using the HiFi DNA Assembly cloning kit (NEB). MntS was cloned into pGEX-6-1 and the GST-MntS fusion was subcloned into pKT25c such that the resulting plasmid lacked the T25 region ...
-
bioRxiv - Microbiology 2023Quote: The ΔmntP::mneA replacement strain was generated by cloning the KanR cassette from pKD4 next to the mneA gene in pJS4B using the HiFi DNA Assembly cloning kit (NEB) (41) ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Genomics 2023Quote: Small RNA libraries were prepared using the NEBnext small RNA library kit for Illumina (New England Biolabs, Cat. No E7330S), following the standard protocol with the following parameters ...
-
bioRxiv - Microbiology 2023Quote: ... DNA libraries were prepared from extracted gDNA using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB). DNA was purified and size selected using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2023Quote: High molecular weight genomic DNA was extracted from freshly pelleted cells using the Monarch Genomic DNA Purification kit (New England Biolabs). Immediately after extraction ...
-
bioRxiv - Physiology 2023Quote: ... Single and double mutations targeting the candidate residues identified by computational modeling were generated by the Q5 Site-directed mutagenesis kit (New England BioLabs). More complex compound mutations were generated in synthetic gene fragments (TWIST Bioscience) ...
-
bioRxiv - Molecular Biology 2023Quote: G4tr (UUAGGG)4 and G4mt (UUACCG)4 were prepared using an in vitro the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) following the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each fraction containing protein-bound RNA was purified and prepared for RNA-sequencing library using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). All the libraries were sequenced on a NextSeq 500 sequencer (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... Point mutations were introduced in the N sequence by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Systems Biology 2023Quote: ... Total RNA library preparation was done by introducing 500 ng total RNA into Illumina’s NEBNext Ultra II directional mRNA (UMI) kit (NEB, E7760S), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Library quality was assessed using an Agilent Tapestation 4200 instrument and quantity determined by qPCR using an NEBnext library quantification kit (NEB). Libraries were sequenced as described previously46 and reads are available from ArrayExpress using accession code E-MTAB-11906 ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples were DNAse treated with the Turbo DNAse (Thermo-Fisher) followed by cleanup with the Monarch RNA Cleanup Kit (NEB). Reagents were used according to the manufacturer’s recommendations.
-
bioRxiv - Developmental Biology 2023Quote: ... Mutagenesis of csn-5(D152N) was performed using a Q5 site-directed mutagenesis kit per manufacturer instructions (New England BioLabs). For transgenic lines used in PLA ...
-
bioRxiv - Plant Biology 2023Quote: ... To allow BiFC imaging of pSITE and pROK based sYFP tags the pSITE YFPc sequences were extended and pSITE YFPn sequences shortened accordingly using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) and the primers listed in Table S1.
-
bioRxiv - Plant Biology 2023Quote: ... A cDNA clone for the 2b protein of Ho-CMV was recapitulated by site-directed mutagenesis of the coding sequence of the Fny-CMV 2b protein using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The resultant DNA product encoding the recapitulated Ho-CMV 2b protein contained the amino acid substitutions S47A ...
-
bioRxiv - Systems Biology 2023Quote: ... the library pool ranging from 135 to 146 bp including the DNA marker were gel purified and quantified by NEBNext Library Quant kit (NEB) using QuantStudio 5 Real-Time PCR System (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: The EEF1A2 CDS was cloned into pcDNA3.1-FLAG (gift from Saunders Lab) using NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) according to the protocol of the manufacturer ...
-
bioRxiv - Plant Biology 2023Quote: ... The fragments were then transferred into pGGA000 in a Golden Gate assembly reaction using the NEBridge Golden Gate Assembly Kit (BsaI-HF v2) (New England Biolabs). To clone the transcriptional reporter lines ...
-
bioRxiv - Systems Biology 2023Quote: ... The pool was amplified by asymmetric PCR followed by being assembled into PRDA_550 vector to acquire the designed library through NEBridge® Golden Gate Assembly Kit (BsmBI-v2) (New England Biolabs). The assembled product was transformed into NEB® Stable Competent E ...
-
bioRxiv - Developmental Biology 2023Quote: ... The corresponding bands were cut out and pooled all in one tube followed by purification using the Monarch DNA Gel extraction Kit (T1020; NEB) and subsequently repurified using the DNA cleanup kit (T1030 ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Genomics 2023Quote: Directional poly(A)+ RNA-Seq libraries were prepared using 300 ng of DNase-treated RNA using the Poly (A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... RNA-seq poly-A libraries were generated with NEBNext UltraII directional RNA library prep kit for Illumina (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Verification of modification of the pv6 locus was performed by first isolating genomic DNA from transfected parasites (Monarch genomic DNA isolation kit, New England Biolabs). Integration of targeting plasmid at the pfs47 locus was determined with primer pairs CVO119-CVO120 (wildtype locus and integrated locus) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The RNA fusion targets were transcribed from plasmids using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA), isolated using the Monarch Kit (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA samples from lungs at 4 dpi were subjected to library preparation using NEBNext Ultra II Directional RNA Library prep kit for Illumina (New England Biolabs) and sequenced on an Illumina NovaSeq 6000 with 150 base pair-end reads at Azenta ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quality control and quantification of the resulting dual-indexed barcoded libraries was performed with Agilent TapeStation and by qPCR (NEBNext Library Quant Kit for Illumina, New England Biolabs).
-
bioRxiv - Genetics 2023Quote: ... whole genome bisulfite sequencing single indexed libraries were generated using NEBNext Ultra DNA library Prep kit for Illumina (New England BioLabs) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... then adapter ligation was carried out using the sequencing adapters supplied with the kit and NEB Blunt/TA Ligase Master Mix (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: All RPL39 variants were cloned into the pRS413-GPD plasmid digested by the BamHI and SalI using the Gibson assembly kit (NEB). Guide blocks (IdT ...
-
bioRxiv - Genomics 2023Quote: Sequencing libraries were prepared with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB, #E7765L) in 96-well plates ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library was resolved on a 1% agarose gel and the smear between 300-600 bp was extracted using Monarch DNA Gel Extraction Kit (New England Biolabs).