Labshake search
Citations for New England Biolabs :
8851 - 8900 of 10000+ citations for Human Oxidized low density lipoprotein receptor 1 OLR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... Whole metagenome sequencing libraries were prepared from 26 µL of DNA solution using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs). The DNA was purified and size selected to remove excess adaptors and adaptor dimers using Ampure XP beads (Beckman Coulter Life Sciences) ...
-
bioRxiv - Neuroscience 2023Quote: ... mutations were created in the chromoshadow domain of HP1γ in pGEMT-KpnI-HP1γ using the Q5 site-directed mutagenesis kit (New England Biolabs) according to manufacturer’s instructions (Data S1) ...
-
bioRxiv - Systems Biology 2023Quote: ... and total RNA libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs), using 700ng of RNA per sample ...
-
bioRxiv - Microbiology 2023Quote: ... Cloning was performed by assembling the purified PCR fragments into the specified pET derivative expression vector using the commercially available NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... A stop codon was inserted after amino acid residue 370 by site directed mutagenesis using Q5 Site-Directed Mutagenesis Kit (NEB), in order to express the truncated N1-370 construct ...
-
bioRxiv - Genomics 2023Quote: ... 170-200 ng of library was indexed using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). The manufacturer’s protocol was followed with the following deviations ...
-
bioRxiv - Genetics 2023Quote: ... Genomic DNA from single adult male flies was extracted using using the Monarch Genomic DNA Purification Kit (New England Biolabs), using a protocol we developed (dx.doi.org/10.17504/protocols.io.bp2l694qklqe/ v1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 500ng of total RNA were used for RNA-Seq library preparation with the NEBNext Ultra II RNA Library Prep Illumina Kit (NEB) and sequenced with the NextSeq 500/550 sequencing platform (performed at the NYUAD Sequencing Center within the NYUAD Core Technology Platform) ...
-
bioRxiv - Plant Biology 2022Quote: ... Libraries were then generated using 10 ng of DNA and NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng RNA was used for library preparation using NEBNext Ultra II Directional RNA Library Prep kit (NEW ENGLAND BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... the C-terminus of the Apoptin encoding plasmid was removed and replaced with the Mxe-GyraseA Intein using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs). Sanger sequencing of resulting plasmids was carried out by GENEWIZ.
-
bioRxiv - Molecular Biology 2023Quote: RNA-seq libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing libraries were quantified by qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... pLENTI-CMV-GPRC5A was mutated to remove m6A sites (A57G, G120T, C174T, A264G) using Q5 site directed mutagenesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The amplicons were inserted into pMQ123 downstream of the Ptac promoter using the NEBuilder HiFi DNA Assembly kit (New England BioLabs) according to the manufacturer specifications ...
-
bioRxiv - Microbiology 2023Quote: Reporter fusions of sRNA targets were in-vitro translated in the absence and presence of sRNA using the PURExpressⓇ In Vitro Protein Synthesis kit (NEB). Four picomoles of in-vitro transcribed 5’UTR reporters (including the RBS/sRNA interaction site and the first 10 codons of flgM ...
-
bioRxiv - Cancer Biology 2022Quote: ... the fragments were purified and used for adapter ligation and library amplification using the NEBNext Ultra II Fs DNA Library kit for Illumina (NEB # E7805, New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: RNA-Seq Libraries were generated using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB). The RNA-Seq libraries were quantified by Qubit and qPCR according to the Illumina Sequencing Library qPCR Quantification Guide and the quality of the libraries was evaluated on Agilent Bioanalyzer 2100 using the Agilent DNA-1000 chip ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA-sequencing libraries were prepared from 500 ng total RNA using the Ultra II directional RNA library preparation kit (NEB) in combination with the NEBNext Poly(A ...
-
bioRxiv - Microbiology 2023Quote: ... GPRC5A-FLAG and GPRC5A expressing plasmids were generated by PCR of the entire coding sequence of GPRC5A from TREx BCBL1-Rta cDNA and cloning using NEBuilder HIFI DNA assembly kit (NEB) into pLENTI-CMV-GFP-PURO ...
-
bioRxiv - Neuroscience 2023Quote: ... and cDNA was prepared with Protoscript II first-strand cDNA synthesis kit as per manufacturer’s protocol (New England Biolabs, USA). The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a knockout construct was assembled into the suicide plasmid vector pZDJ 78 with either the Gibson Assembly Cloning Kit or the NEBuilder HiFi DNA Assembly Master Mix (both New England Biolabs). The antibiotic resistance cassette flanked by flippase recognition target (FRT ...
-
bioRxiv - Genomics 2022Quote: ... DNA was ultrasonicated to a fragment size of 270 bp and the library was prepared using an Ultra DNA Library Prep Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The V7 variant of AR was generated from peGFP-C1-AR using the Q5 site-directed mutagenesis kit and primer design tools (New England BioLabs) with the following primer pair:
-
bioRxiv - Developmental Biology 2022Quote: ... Deletions within the nhr-23 3′ UTR reporter (cloned in pHR017) were created using a Q5 Site-Directed Mutagenesis Kit (NEB) and verified by Sanger Sequencing (Genewiz Inc.) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the eluted DNA was used to make sequencing libraries using the NEBNext Ultra or Ultra II DNA Library Prep Kit for Illumina (NEB) with NEBNext Multiplex dual index primers with 12 amplification cycles and 2 additional AMPure XP clean-up steps at 0.8X ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteinase K was inactivated (20 min 82 °C) and the crRNA target site was amplified with One Taq Hot Start DNA polymerase kit (NEB), followed by Sanger sequencing (primers in Table S3) ...
-
bioRxiv - Cell Biology 2023Quote: ... Library quality was confirmed using an Agilent BioAnalyzer 2100 and quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs). Sequencing was performed using the Illumina NextSeq500 platform employing a single-end ...
-
bioRxiv - Microbiology 2023Quote: ... Transcription and fluorescent labelling of RNA in vitro transcription reactions were carried out using a T7 RNA transcription kit (HiScribe T7 High Yield; New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and p.2.5’ genomic RNA was generated by in vitro transcription using the HiScribe™T7 ARCA mRNA kit (New England Biolabs). For ZIKV-WT ...
-
bioRxiv - Cell Biology 2023Quote: ... and library prep performed on the beads using the NEBNext Ultra II DNA library prep kit for Illumina (NEB, E7645L), according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and the extracted RNA was reverse transcribed using LunaScript® RT SuperMix Kit (Cat. NEB #E3010; New England Biolabs, MA). The feline IFNγ mRNA were evaluated using primers (5’AATACCAGCTCCAGTAAACGG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... and the extracted RNA was reverse transcribed using LunaScript® RT SuperMix Kit (Cat. NEB #E3010; New England Biolabs, MA). The feline IFNγ mRNA were evaluated using primers (5’AATACCAGCTCCAGTAAACGG 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription was performed on 500 ng of total RNA using a LunaScript™ RT SuperMix Kit (New England Biolabs) as according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR for SARS-CoV-2 from cell lysates was performed using the TaqMan assay for the CDC N1 gene primers and probes from Integrated DNA Technologies (catalog no. 10006600; Integrated DNA Technologies) using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) as previously described (6) ...
-
bioRxiv - Microbiology 2023Quote: In vitro transcription reactions were carried out using a T7 RNA transcription kit (HiScribe T7 High Yield; New England Biolabs) with the following modifications ...
-
bioRxiv - Immunology 2022Quote: ... capture and RNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... performed to exchange the previous gRNA sequence was achieved using a Q5 mutagenesis kit (New England Biolabs, Ipswich, Massachusetts, USA). gRNA sequences were inserted into pTREX-n-Cas9 using primers specific to the gene of interest in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2023Quote: ... PYD and HD mutants were generated from full length IFI207-HA plasmids and the R1-PYD mutant from R1-IFI207 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). IFI207-HIN plasmids were generated by PCR amplification of the HIN domain from full length IFI207-V5 expression plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... pDS01 and pDS02 were constructed by restriction digestion with BamHI and SbfI followed by ligation with a Quick Ligation Kit (NEB). All other plasmids were constructed using a HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA samples were then subjected to qRT-PCR of BB0838 and flaB transcripts using the Luna Universal One-Step RT-qPCR kit (NEB) and an ABI Prism 7500 system (Applied Biosystems ...
-
bioRxiv - Genetics 2023Quote: ... whole genome bisulfite sequencing single indexed libraries were generated using NEBNext Ultra DNA library Prep kit for Illumina (New England BioLabs) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... then adapter ligation was carried out using the sequencing adapters supplied with the kit and NEB Blunt/TA Ligase Master Mix (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: All RPL39 variants were cloned into the pRS413-GPD plasmid digested by the BamHI and SalI using the Gibson assembly kit (NEB). Guide blocks (IdT ...
-
bioRxiv - Genomics 2023Quote: Sequencing libraries were prepared with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB, #E7765L) in 96-well plates ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library was resolved on a 1% agarose gel and the smear between 300-600 bp was extracted using Monarch DNA Gel Extraction Kit (New England Biolabs).
-
bioRxiv - Genomics 2023Quote: ... we used the NEB Next PPFE repair kit with Ultra II end prep reaction (New England Biolabs, Ipswich, MA, USA) under recommended conditions and Nanopore ligation sequencing kit SQK-LSK110 ...
-
bioRxiv - Genomics 2023Quote: ... RNA-seq poly-A libraries were generated with NEBNext UltraII directional RNA library prep kit for Illumina (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was submitted to Genome Quebec for library preparation using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs) and 150 bp paired-end shotgun sequencing on an Illumina NovaSeq 6000 platform.
-
bioRxiv - Plant Biology 2023Quote: ... The fragments were then transferred into pGGA000 in a Golden Gate assembly reaction using the NEBridge Golden Gate Assembly Kit (BsaI-HF v2) (New England Biolabs). To clone the transcriptional reporter lines ...
-
bioRxiv - Developmental Biology 2023Quote: ... The corresponding bands were cut out and pooled all in one tube followed by purification using the Monarch DNA Gel extraction Kit (T1020; NEB) and subsequently repurified using the DNA cleanup kit (T1030 ...