Labshake search
Citations for New England Biolabs :
8551 - 8600 of 10000+ citations for Mouse Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... which were subsequently transcribed to produce copies of the mRNAs using an in vitro transcription kit (New England Biolabs, UK) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... or SalI (pT7/SL3 or pT7/FLC background) and RNA transcribed using a HiScribe T7 High Yield RNA Synthesis kit (NEB) following the manufacturers’ protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... the BsaI cut site present in the newly assembled vector was converted to a BsmBI cut site using the Q5 Site-Directed Mutagenesis kit (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... Ribosomal RNA was removed from the samples using NEBNext® Ultra™ Directional RNA Library Prep Kit (NEB, Massachusetts, U.S.). Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... a cysteine was added to the N-terminus of the coding sequence directly after the precision protease recognition site or after the six-histidine tag on the C-terminus using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2019Quote: ... 750 ng RNA were used to build the next generation sequencing libraries with the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs), NEBNext Poly(A ...
-
bioRxiv - Molecular Biology 2019Quote: ... 50 ng of DNA in 50 ul water was used for library preparation using the Ultra II library kit (NEB) as per the manufacturer’s instructions with 6 cycles at the amplification step.
-
bioRxiv - Neuroscience 2021Quote: ... guide RNA (gRNA) sequences were inserted into pU6-BbsI-chiRNA 54 using the Q5 site-Directed Mutagenesis Kit (New England Biolabs). Each PCR used a common primer GAAGTATTGAGGAAAACATA and a primer containing the gene specific gRNA sequence followed by GTTTTAGAGCTAGAAATAGC ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA library preparation was performed according to the standard protocol of the NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs). The synthesized double-stranded cDNA was end-repaired using NEBNext End Prep Enzyme Mix before ligation with NEBNext Adaptor for Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted as above and 300 ng of total RNA was used for library preparation using the NEBNext Ultra II Directional Library Prep Kit for Illumina with the mRNA isolation module and NEBNext Multiplex Oligos for Illumina (New England Biolabs). DNA quality was assessed by Fragment Analyzer NGS (Agilent) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were constructed from 2.5 ng of DNA and prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina with 9 PCR cycles (NEB #E7645S, New England Biolabs). Library quality was assessed by High Sensitivity DNA Assay on an Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... The NEBNext Ultra Directional RNA Library Prep Kit for Illumina was used to process the samples according to the protocol NEB #E7420S/L (New England Biolabs) to fragments of 300-500 bps ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sgRNA products synthesized by VSW-3 RNAP and T7 RNAP were purified with Monarch RNA Cleanup kit (New England Biolabs) and then further purified by high performance liquid chromatography (HPLC ...
-
bioRxiv - Molecular Biology 2021Quote: Micro-C sequencing libraries were generated by using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645) with some minor modifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA-seq library was prepared using NEBNext® Ultra™ directional RNA library prep kit (New England BioLabs, MA, USA) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... mRNA was isolated and sequencing libraries prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs) by the Centre for Genomic Research (University of Liverpool) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA-Seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, cat# E7760S) with the NEBNext rRNA Depletion Kit (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: HA-AHCY was purchased from VectorBuilder and mutations were introduced by PCR-based mutagenesis using Q5 Site-Directed Mutagenesis Kit (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mRNA abundance levels were determined using 200 ng total RNA for each sample in technical replicates using Luna Universal One-Step RT-qPCR kit (New England BioLabs) and SYBR Green as detection agent and gene-specific primers (Table S2) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two fragments were cloned into KpnI/SpeI-digested pMDC32 vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The three DNA fragments were cloned into SacII/XhoI-digested pUC57-TAS3a via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The two fragments were cloned into KpnI/SpeI-digested pMDC32 vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The two DNA fragments were inserted into EcoRV/SmaI-digested pEU-E01-MCS vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The two fragments were cloned into KpnI/SpeI-digested pMDC32 vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The two fragments were cloned into KpnI/SpeI-digested pMDC32 vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The two fragments were cloned into KpnI/SpeI-digested pMDC32 vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... the pyrimidines present in the TOP motif of the reporters were replaced with purines using Q5 site directed mutagenesis kit (NEB) as per the manufacturer’s protocol using the oligos listed in the Supplementary file 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and up to 100 ng of RNA was used for library preparation using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB). The libraries were prepared according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: All genome-editing plasmids were constructed using the seamless cloning with Golden Gate Assembly using NEB Golden Gate Assembly Kit (BsaI-HF v2) (E1601, New England Biolabs). The ODNs for Golden Gate Assembly were automatically designed with an in-house software.
-
bioRxiv - Molecular Biology 2021Quote: ... Deletion of S106 and T107 was performed from the wt template above using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs) and sequence verified ...
-
bioRxiv - Molecular Biology 2021Quote: Sequencing libraries were generated from 1.2 ng of DNA using the NEBNext Ultra II DNA library preparation kit (NEB, E7645) with 9 cycles of PCR ...
-
bioRxiv - Biophysics 2022Quote: ... was performed using plasmid pHSCRP-His6-H17C-C178S [constructed from plasmid pAKCRP-His6 (16) using site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, NEB)].
-
bioRxiv - Biophysics 2022Quote: ... single point mutations were introduced to the respective wild-type plasmids by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (NEB). The used primers are listed in table 1.
-
bioRxiv - Evolutionary Biology 2022Quote: ... library sequence and terminator was PCR amplified to serve as template for in vitro transcription (NEB HiScribe T7 kit, USA). The PUREfrex 2.0 system (GeneFrontier Corporation ...
-
bioRxiv - Cell Biology 2022Quote: ... 1mg of RNA was used to generate sequencing libraries using NEBNext Ultra II Directional RNA library Prep Kit for Illumina (NEB) according manufacturer’s recommendation ...
-
bioRxiv - Cell Biology 2022Quote: ... Second strand cDNA synthesis was performed with 1X SSS buffer and SSS enzyme (NebNext mRNA second strand synthesis kit NEB; thermocycler program ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA was extracted with a Sodium Dodecyl Sulfate (SDS) protocol from whole bodies and sequencing libraries were built with NEBNext DNA Library Prep Kits (New England Biolabs) by Novogene (Hong Kong).
-
bioRxiv - Immunology 2022Quote: ... the purification of PolyA containing mRNA molecules using poly-T oligo attached magnetic beads from 100ng total RNA (with the Magnetic mRNA Isolation Kit from NEB), a fragmentation using divalent cations under elevated temperature to obtain approximately 300bp pieces ...
-
bioRxiv - Immunology 2022Quote: ... was amplified from the synthetic S gene and cloned into the EcoRI and HindIII digested pXC17.4 CHO expression vector with a secretion signal sequence using NEBuilder HiFi DNA assembly kit (New England Biolabs, E5520). Similarly ...
-
bioRxiv - Genomics 2020Quote: Synthetic SARS-CoV-2 RNA templates were serially diluted and amplified by RT-LAMP using the WarmStart LAMP Kit (NEB). LAMP primers were added to a final concentration of 0.2µM for F3 and B3 ...
-
bioRxiv - Genomics 2020Quote: Small RNA sequencing libraries were generated using the NEBNext Small RNA library Prep kit and NEBNext multiplex oligos for Illumina according to the manufacturer’s instructions (New England Biolabs, E7300). The final small RNA libraries were purified from 6% PAGE gel ...
-
bioRxiv - Genomics 2020Quote: ... In vitro transcription was performed using HiScribe T7 high yield RNA synthesis kit according to the manufacturer’s protocol (NEB, E2040S). In vitro synthesized RNAs was treated with 10U RNAse-free DNAse I (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... using 6 µg input 3C DNA as previously described8 or using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). When using the Ultra II kit 3 µg 3C material was sonicated to 200 bp as previously described8 ...
-
bioRxiv - Genomics 2020Quote: The lentiviral vector for expressing TIR1 (Lentiv4-EFsp-Puro-2A-TIR1-9Myc) was constructed using PCR and Gibson Assembly Cloning kit (New England Biolabs). The backbone was modified from lentiCRISPR v259 (a gift from Feng Zhang ...
-
bioRxiv - Genomics 2020Quote: PCR3 was performed by subtracting 2-3 cycles from the Ct and using 2.5 uL of a mix of distinct indexed primers from the NEBNext Dual Index Kit for Illumina (New England Biolabs) using 22.5 uL PCR2 product in a 50 uL reaction volume (Q5 UltraII mastermix with EvaGreen (Biotium) ...
-
bioRxiv - Genomics 2020Quote: ... High quality RNA was subjected to library preparation using NEBNext Ultra™ RNA Library Prep Kit for Illumina (NEB, USA). The libraries were sequenced on a HiSeq X Ten sequencer (Illumina) ...
-
bioRxiv - Microbiology 2020Quote: ... Genes with internal restriction sites for any of these two enzymes were subcloned into the same vector using the HIFI DNA Assembly kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... and Illumina-sequencer-compatible libraries were constructed by using an NEBNext Ultra II DNA Library Prep Kit (New England Biolabs).
-
bioRxiv - Genomics 2020Quote: The immunoprecipitated sample and the input were subjected to Nextera library preparation as described by the manufacturer (NEBNext Ultra II DNA library Prep Kit for Illumina, NEB). The quality and size of libraries and chromatin shearing fragments were checked by Agilent Bioanalyzer using Agilent DNA High Sensitivity Chips (Agilent Technologies) ...