Labshake search
Citations for New England Biolabs :
8801 - 8850 of 10000+ citations for Mouse Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... myc epitope tag insertion and TEXEL2 point mutations were introduced into pTub-Gra44-HPT using the Q5 site directed mutagenesis kit (NEB) and TEXEL point mutations were accomplished similarly with Quikchange site-directed mutagenesis kit (Agilent).
-
bioRxiv - Genomics 2020Quote: ... end repaired DNA using the Ligation Sequencing kit (SQK-LSK-109; Oxford Nanopore) and NEBNext Ligation Module (New England BioLabs). Following a further 0.4 x volume Ampure-XP purification ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-Seq libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs # E7420S) by following the company’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Purified ChIP DNA was used to prepare Illumina multiplexed sequencing libraries using the NEBNext Ultra II DNA Library Prep kit and the NEBNext Multiplex Oligos for Illumina (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fragments were end-repaired and ligated with Illumina compatible adaptors using the NEBNext UltraTM II DNA Library Prep Kit (NEB). The adaptor-ligated DNA was hybridized to custom Agilent biotinylated oligonucleotide probes across a 700bp region (53032 probes ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGEX-GST-p130593-790 R680A L682A were generated by site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (New England BioLabs, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Cell Biology 2021Quote: RNA sequencing libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina using manufacturer’s instructions (NEB, MA). mRNAs were enriched with Oligod(T ...
-
bioRxiv - Cell Biology 2020Quote: ... CASP1 and CASP4 CDS were amplified from the obtained library and cloned into the pMSCV-puro vectors The caspase-4 catalytically dead C258A pMSCV-puro vector was generated from the wild-type pMSCV-puro-CASP4 through site-directed mutagenesis by PCR using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The CASP4 and GSDMD-targeting lentiviral vectors (pGIPZ ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated with the PureLink RNA Mini Kit (12183018A, Thermo) and cDNA was synthesized with ProtoScript First Strand cDNA (E6300S, New England Biolabs). RT-PCR was performed with the Power SYBR Green PCR Master Mix 2X (4367659 ...
-
bioRxiv - Biophysics 2021Quote: SARS-CoV-2 S N501Y plasmid was obtained from SARS-CoV-2 S plasmid (HDM-IDTSpike-fixK) by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs). SARS-CoV-2 S and SARS_CoV-2 S N501Y pseudotyped retroviral particles were produced in HEK293T cells as described previously (29) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed for 60 min at 42 °C and 5 min at 80 °C using ProtoScript II First Strand cDNA synthesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Adapters were ligated using the Genomic DNA by Ligation kit (SQK-LSK109, Oxford Nanopore Technologies) and NEBNext Quick T4 DNA Ligase (E6056, NEB) followed by AMPure XP bead clean-up ...
-
bioRxiv - Cell Biology 2021Quote: ... coding sequence was amplified from Arabidopsis cDNA and assembled into a pGreen0179-35S-spFLA11-His-YFP vector using NEBuilder HiFi DNA Assembly kit (NEW ENGLAND Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Library construction was performed with 20ng of input total RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina - polyA mRNA workflow (New England Biolabs). The libraries were sequenced with a NextSeq 500 High Output 75 cycle kit (Illumina) ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments were cloned into the srpHemo plasmid using an Infusion HD cloning kit after its linearization with NotI (NEB).
-
bioRxiv - Genomics 2019Quote: ... Illumina sequence libraries were prepared using the NEB Next Ultra Directional RNA Library Prep Kit (New England Biolabs, Ipswich, MA). Quality and quantity of the cDNA libraries were validated with a Tapestation 2200 Instrument (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... and the other lacking a conserved region of the FAB domain (1937-2051aa, 115aa) using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). We generated a 282bp deletion of the PDZ domain to create the cnoΔPDZ-GFP ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2022Quote: ... Linearized plasmids were used as templates and RNA products were then produced using the HiScribe T7 RNA Synthesis Kit (NEB) per manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2022Quote: Sequencing libraries were prepared using the NEBNext Ultra II Directional Kit with polyA selection module (New England Biolabs, MA, USA). In brief ...
-
bioRxiv - Molecular Biology 2022Quote: 1 μg of total RNA was used to synthesize cDNA with dTALE gene specific primer dTALE-GSP_R0 (cgacttgagcagcaggagatgc) using the ProtoScript®II first strand cDNA synthesis kit (New England Biolabs) according to the manufacturer’s manual ...
-
bioRxiv - Biochemistry 2022Quote: ... transcripts containing artificial 5’ UTRs were performed using PCR-amplified templates and the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... After depletion 80 ng of each RNA sample was used to synthesized cDNA and make a library using the NEBNext Ultra Directional RNA library kit for Illumina (NEB).
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA enrichment and library preparation was performed using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II RNA Library Prep kit (NEB). Sequencing was done using the Illumina NextSeq500 to obtain >20 million 75bp single-end or 37bp paired-end reads per sample or at Genewiz (HiSeq ...
-
bioRxiv - Microbiology 2022Quote: ... 1μg of input RNA was used for RNA library preparation using the NEB Next Ultra II RNA Library Prep kit for Illumina (E7775L; NEB). Prepared libraries were quantified using real time PCR and bioanalyzer ...
-
bioRxiv - Genetics 2022Quote: ... We prepared the libraries with the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs, Ipswich, Massachusetts, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Small RNA-seq libraries were generated from the small RNA fraction by TCAG using NEBNext Small RNA Library Kit (New England BioLabs) according to the manufacturer’s protocol in two batches ...
-
bioRxiv - Cancer Biology 2022Quote: ... The L325R mutation was introduced to the EGFP-talin1 head construct using the Q5-site directed mutagenesis kit (NEB, E0554).
-
bioRxiv - Biochemistry 2022Quote: The mutant constructs used in this paper were prepared by point directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (NEB). Primers were designed and annealing temperatures determined using the NEBase Changer tool ...
-
bioRxiv - Developmental Biology 2022Quote: ... PE3-EGFP-2-Fw and PE3-EGFP-2-Rv) were annealed and inserted into the BsmBI sites of BPK1520 using a Quick Ligation Kit (New England BioLabs). PuroR cDNA was amplified from PX459 with primers (PuroR-Fw ...
-
bioRxiv - Developmental Biology 2022Quote: ... and integrated into a MluI-NheI site of pT2A-CAGGS (Urasaki et al., 2006) using a Gibson Assembly Kit (New England BioLabs). To obtain pT2A-CAGGS-PEmax-ires-ZsGreen1 ...
-
bioRxiv - Biochemistry 2022Quote: ... the serine residues S240 and S250 in Dsn1 were mutated to aspartic acid using the Q5 site-directed mutagenesis kit (New England Biolabs) as described previously 19,20 ...
-
bioRxiv - Biochemistry 2022Quote: ... Site-directed mutagenesis to create the EcGhrAW45F variant was performed using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) using the mutagenic primers 5’-TGCTTTAGTCTTTCATCCTCCTG-3’ (forward ...
-
bioRxiv - Genetics 2022Quote: ... This pooled mixture was run on a 2% agarose gel and we extracted and purified DNA in the 400 bp to 600 bp region using the Monarch Gel Extraction Kit (NEB) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2022Quote: ... We used this synthetic HIS3 fragment and BsmBI-v2/HpaI-digested PFA0055 to create plasmid PFA0227 by isothermal assembly cloning using the HiFi Assembly Cloning Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... All samples were processed in a single batch and the isolated mRNA from each sample was used to prepare RNA sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... We then combined SwaI digested BFA0190 and the components of each TFT reporter and used the NEB HiFi Assembly Kit (NEB) to produce each TFT plasmid ...
-
bioRxiv - Genomics 2022Quote: Illumina libraries were constructed from 100 ng of amplified cDNA libraries using the NEBNext Ultra II FS library prep kit for Illumina (New England Biolabs) with some modifications ...
-
bioRxiv - Biochemistry 2022Quote: ... CXCR7 phosphorylation site mutants were generated by site-directed mutagenesis using Q5 Site-Directed Mutagenesis Kit (NEB, Cat. no. E0554S). For the NanoBiT assay ...
-
bioRxiv - Biochemistry 2022Quote: ... The library was cloned into a pENTR1A plasmid backbone with a C-terminal YFP HA reporter tag using Gibson Assembly (HiFi DNA Assembly Cloning Kit, New England Biolabs, (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2022Quote: ... Single and multiple point mutation modifications to the pcDNA C12 construct were generated through the Q5 Site-directed Mutagenesis kit (NEB) or purchased as a minigene from Integrated DNA Technologies (IDT ...
-
bioRxiv - Genetics 2022Quote: ... and extracted and purified DNA in the 400 bp to 600 bp region using the Monarch Gel Extraction Kit (NEB) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... Mutation of the verified 7-mer binding site of the 3’-UTR of Zfp36l1 was performed using the Q5-site directed mutagenesis kit (New England BioLabs) using the following primers ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription (IVT) was performed at 37°C for 13-16h with the HiScribe T7 RNA Polymerase kit (NEB). The remaining DNA was digested by Turbo DNase I (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... and subsequently modifying the plasmid to add the HA-tag coding sequence using the Q5 Site-Directed Mutagenesis kit (NEB) or the mEos3.2 coding sequence using InFusion (Clontech) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Extracted gDNA was prepared for sequencing using a modified protocol63 for the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) at ½ of the recommended reaction volume ...
-
bioRxiv - Physiology 2022Quote: ... Stranded cDNA libraries were created with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The 30 fish were sequenced for 100 base pair reads on one lane of a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Concentrations were measured by Qubit RNA HS assay kit and 750 ng of Dnase-treated RNA was used for rRNA depletion by NEB Next rRNA depletion kit (Human/Mouse/Rat) ...
-
bioRxiv - Microbiology 2022Quote: ... for removal of contaminating genomic DNA before it was purified with Monarch® RNA cleanup kit (New England Biolabs, USA). The concentration of RNA and potential DNA contamination were quantified using Qubit™ RNA BR and Qubit™ dsDNA HS assay kits ...