Labshake search
Citations for New England Biolabs :
801 - 850 of 2049 citations for 6 Benzyloxy 1H indole 2 boronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 2 units of HindIII per reaction well (New England Biolabs # R0104S), 600 nM of each primer (Pol and ENV ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ul of micrococcal nuclease (Biolabs M02475, 2×106 U/ml) was added to 200 μl buffer containing 1 mM CaCl2 and incubated for 10 min 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 16 U/µl of T4 RNA ligase 2 truncated KQ (NEB), 10°C 20 h ...
-
bioRxiv - Microbiology 2022Quote: ... 1× LongAmp® Taq 2× Master Mix (New England Biolabs, UK), and 2 μL of a unique barcode ...
-
bioRxiv - Genomics 2023Quote: ... DNA was pre-amplified with 2× NEBNext Master Mix (NEB M0541S). Library amplification was assessed by qPCR on Applied Biosystems QuantStudio 3 real-time PCR system ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2’-O-methylations were also detected by RNase H (NEB, M0297S) digestion of 2 μg with 25 pmol chimeric RNA-DNA probes ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were PCR-amplified (12.5 μL NEBNext High-Fidelity 2× NEB PCR Master Mix ...
-
bioRxiv - Biophysics 2023Quote: ... and 5 U Klenow in 1× NEBuffer 2 (New England BioLabs) (120 μL total volume ...
-
bioRxiv - Cancer Biology 2023Quote: ... plasmid DNA (2 µg) was digested with BsmBI-v2 (NEB, R0739) at 55°C for 3 h ...
-
bioRxiv - Genetics 2023Quote: ... diluted to 2 mg/ml in Nuclease-Free Water (NEB, B1500L), at 37°C for 15 minutes each ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml Tris buffer ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Genetics 2023Quote: ... 5μL of 2× Luna Universal qPCR Master Mix (NEB, MA, USA). The amplification program was set as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl Klenow enzyme (5 units/µl, New England Biolabs, M0210S), and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche ...
-
bioRxiv - Genomics 2023Quote: ... a hybridization reaction was carried out in 1X Buffer 2 (NEB). 10 µM pool of designed oligomers and 10 µM of a complementary-overlap-containing-oligomer were first denatured at 95°C for 15 seconds and allowed to hybridize at 43°C for 5min ...
-
bioRxiv - Genomics 2023Quote: ... 0.3 μg DNA was digested with 2 U DpnI (NEB R0176S) or 5 U MboI (NEB R0147S ...
-
bioRxiv - Cancer Biology 2023Quote: ... For nucleosomes labeling reaction mix contained: NEBuffer™ 2 (NEB B7202), protease and HDAC inhibitors (as detailed above) ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 µL NEBNext HiFi 2× PCR Master Mix (New England BioLabs) was added to the DNA mixture ...
-
bioRxiv - Molecular Biology 2023Quote: ... or RNase A (2 µg, Monarch RNase A; New England Biolabs) and incubating for another 15 min at 25°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μL of 10x DNase I Buffer (New England Biolabs, #m0303s), 1 μL of rDNase I (ThermoFisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 µl of Gel loading dye without SDS (NEB, Ipswich, MA) were added to each reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Genomics 2024Quote: ... 0.25 μM of adapter and 2 μL of Quick ligase (NEB) for 20 minutes at 23°C in 40 μL ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of PNGase F (New England Biolabs catalog number P0704S), were combined with H2O to achieve a total volume of 10 µL ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of Endo H (New England Biolabs catalog number P0702L), were combined with H2O to reach a total volume of 10 µL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 μL Phusion® HS Flex polymerase (2 U/μL - NEB), in a final volume of 40 μL ...
-
bioRxiv - Microbiology 2024Quote: ... and was loaded onto 2 mL of chitin resin (NEB; #S6651S) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein was digested by adding 2 µL of PK (NEB) to the mixture and incubating at 45°C for 45 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µL of 10X RNase H Buffer (New England Biolabs, M0297S), and 1 µL of RNase H (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... 200 mM NaCl and 2 µl of proteinase K (NEB # P8107S) and incubated overnight at 65°C to lyse nuclei bound to the beads and DNA was extracted using phenol-chloroform and precipitated using glycogen ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl of 10x reaction buffer (New England Biolabs, Ipswich, MA), 2 µl 0.1M DTT ...
-
bioRxiv - Biochemistry 2024Quote: gDNA was digested for 2 h with BamHI and XmnI (NEB). Multiplex 24 μL ddPCR reactions were prepared by mixing 12 μL of ddPCR supermix (no dUTP ...
-
bioRxiv - Cancer Biology 2024Quote: ... Primers Set 1 and 2 (NEB, cat. no. E7335 and E7500). We proceeded by pulling the samples together ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Reverse transcription was performed on 10 μL of RNA using the ProtoScript II Reverse Transcriptase and Random Primer 6 (New England BioLabs, Ipswich, MA, USA) under the following thermal conditions ...
-
bioRxiv - Genomics 2023Quote: ... and chromatin was digested during 10 min at 37 °C with 6 Kunitz units of MNase (New England Biolabs, 200 Kunitz units/µl) per 1 million cells ...
-
bioRxiv - Genomics 2023Quote: ... 2-8 µg of HMW DNA was diluted in 1x CutSmart Buffer and 6 µl of Quick CIP enzyme (New England Biolabs, catalog no. M0508) was added followed by incubation of the reaction at 37°C for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 µM of the 6-kb fragment was incubated with 1 unit/µL terminal deoxynucleotidyl transferase (TdT, New England Biolabs, MA, USA, #M0315S) and 0.5 mM deoxyadenosine triphosphate (dATP ...
-
bioRxiv - Genetics 2024Quote: ... followed by a 10-fold dilution of the universal adaptor and 6 cycles of PCR with the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB, Cat. No. E7805S), and the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... USA) and used to generate sequences with the desired amino acid substitution using Q5 Site-Directed Mutagenesis Kit (NEB, via BioTek, Praha, Czech Republic). Primers were designed using NEBaseChanger (https://nebasechanger.neb.com/) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...