Labshake search
Citations for New England Biolabs :
8401 - 8450 of 9547 citations for QuantiChrom Phosphate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Base editors were cloned into the IVT template vector using NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs, #E5520S) (Extended Data Table 5 ...
-
bioRxiv - Microbiology 2023Quote: RNA extracts from WWI were prepared for RNA sequencing using the NEB Ultra II RNA Sequencing kit (New England Biolabs, E7770S), following manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... was end repaired and adapters were ligated to it following the procedure of the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S), purified using AMPure XP beads and eluted in 50 μL of H2O ...
-
bioRxiv - Microbiology 2023Quote: RNA extracts from WWI samples were reverse transcribed to synthesize cDNA using the LunaScript SuperMix RT kit (New England Biolabs, E3010L); 10 µL of each RNA extract was used in a total reaction volume of 20 µL ...
-
bioRxiv - Genomics 2023Quote: Mouse tail (1cm) was used to extract the genomic DNA (gDNA) using NEB Monarch® Genomic DNA Purification Kit (NEB T3010L). DNA concentration was measured on Qubit dsDNA BR assay kit (cat ...
-
bioRxiv - Immunology 2023Quote: Immunoglobulin libraries were generated from 1 μg of RNA using the NEBNext Immune Sequencing Kit (New England Biolabs, Ipswich, Massachusetts, USA) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and then prepared into a whole-genome shotgun library using the NEB Ultra Library Prep kit (New England Biolabs; Ipswich, MA). Instead of the standard Illumina library prep adaptor ...
-
bioRxiv - Genomics 2023Quote: ... and day 14 post-transfection and genomic DNA (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England Biolabs, T3010L). Target regions were amplified by PCR to add barcodes for multiplexing ...
-
bioRxiv - Immunology 2023Quote: Total RNA was extracted from 107 hybridoma cells using the MonarchTM total RNA extraction kit (New England BioLabs, Ipswich, MA, USA) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... adaptor ligation and PCR indexing was performed on the denatured amplicons using NEB Next Ultra II DNA library prep kit for Illumina (New England Biolabs, UK). The resulting FASTQ files from RNP treated samples for each of the off target amplicons were analysed for indels through CRISPResso2 webtool [45] by comparing them with untreated samples.
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting fragment was then inserted into XhoI and NdeI digested pET21a vector by NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520). As a result ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP libraries were generated with input and pulldown DNA using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB E7645L) for sequencing on an Illumina Nextseq with 75-bp read length and single-end.
-
bioRxiv - Microbiology 2023Quote: ... The NGS library preparation was carried out using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB, USA), which performs fragmentation ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then <5 ng ChIP sample DNA or <20 ng input DNA was used for sequencing libraries using the NEB Next Ultra II DNA Library Prep Kit for Illumina (New England BioLabs, E7645). In Step 1.3 (End Prep) ...
-
bioRxiv - Cell Biology 2023Quote: ... a PCR fragment containing the complete Nv-osk coding sequence was synthesized for protein expression with PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs) using manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the mCherry-SopF coding sequence was cloned into the pPB Piggybac plasmid (Vectorbuilder) using the NEB HIFI DNA Assembly Kit (NEB, E2621L).
-
bioRxiv - Cell Biology 2023Quote: ... RNA-Seq libraries were prepared with NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext® UltraTMII Directional RNA Library Prep Kit (New England Biolabs). Libraries were sequenced using the NovaSeq 6000 system (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacturer’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Cell Biology 2023Quote: ... These fragments were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacture’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Cell Biology 2023Quote: ... The C-KSR-GS construct replacing the vector-based linker (LELKLRILQS) by a glycine-serine rich linker (GGSSGGGGA) was generated by site directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, NEB, USA) of the C-KSR-EGFP plasmid ...
-
bioRxiv - Cell Biology 2023Quote: Capped mRNAs with poly-A tail were synthesized from linearized pGEMHE plasmids using the HiScribe™ T7 ARCA mRNA Kit (NEB). The mRNA was purified by Monarch RNA Cleanup Kit (NEB) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... USA) to enable miniaturized library preparation with the NEBNext Ultra II RNA Library Prep Kit (New England Biolabs, Beverly, MA, USA). Library preparation was performed per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... the tissue samples were stained using Vizgen’s Cell Boundary Kit (Vizgen, 10400009) and blocked in blocking solution (Vizgen, 20300012) supplemented with a 1:20 dilution of Rnase inhibitor (NEB, M0314L) for one hour ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA synthesis and qRT-PCR were performed in a one-pot reaction using Luna® Universal One-Step RT-qPCR Kit (NEB). A QuantStudio Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Developmental Biology 2023Quote: Libraries for RNA sequencing were generated using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB #E6420) in conjunction with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Cell Biology 2023Quote: ... the efficiency of each sgRNA (sg1 to sg5) was verified by extracting genomic DNA (Monarch Genomic DNA Purification Kit, NEB T3010S) and PCR-amplifying the region of the gene targeted by each sgRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown out in LB medium with 50 µg/mL Kanamycin and then pelleted before plasmids were isolated using the Monarch Plasmid Miniprep Kit (NEB, T1010L). Plasmids were sequenced (Sanger ...
-
bioRxiv - Molecular Biology 2023Quote: ... The specimens were then incubated with a 20-fold diluted Quick Ligase in 1x Quick Ligase Reaction Buffer from Quick Ligation Kit (New England Biolabs, M2200), supplemented with an additional 1 mM ATP (TAKARA Bio ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... downstream of the constitutive 35S promoter and upstream of the start codon of the GUS reporter using HiFi DNA assembly cloning kit (NEB E5520). Fragments of 35S promoter + vector backbone + GUS was amplified using forward primer ATGTTACGTCCTGTAGAAACCC and reverse primer GTCGACTCCAAATGAAATGAAC ...
-
bioRxiv - Developmental Biology 2024Quote: ... three sgRNAs for skp2 were designed and synthesized in vitro using HiScribe™ T7 High Yield RNA Synthesis Kit(NEB, E2040S). The Cas9-sgRNA ribonucleoprotein complex (RNP ...
-
bioRxiv - Genomics 2024Quote: ... Zirconium beads (3.0mm) in a bead beater were used to homogenize mosquitoes before proceeding with NEB Monarch Total RNA Miniprep Kit (NEB #T2010). The on-column DNase I treatment was performed during RNA extraction ...
-
A humoral immune response to parasitoid wasps in Drosophila is regulated by JAK/STAT, NF-κB and GATAbioRxiv - Immunology 2024Quote: ... RNAseq libraries were then prepared using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs #E7760S) with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Genetics 2024Quote: ... TLK1 and TLK2 point mutants were generated by site-directed mutagenesis reactions using the NEB Q5 site-directed mutagenesis kit (NEB, E0554S). Primers are listed in Supplementary Table 1.
-
bioRxiv - Pathology 2024Quote: Sequencing library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs, MA). cDNA libraries were sequenced by a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genetics 2024Quote: ... and 0.5–50 ng of DNA/ChIP was used for library preparation using the NEBNext Ultra II DNA Library Kit for Illumina (NEB E7645) and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of RNA was used as input for library preparation using the NEBNext Multiplex Small RNA Library Prep Kit for Illumina (NEB E7560S), according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... The spheres were collected after 24 h and RNA extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs #T2010S). RNA was extracted from adherent cells directly from the plate ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was collected from parental iOvCa147 cells and DYRK1A-/-cells from 24-hour adherent or 6-hour spheroid conditions using the Monarch Total RNA Miniprep Kit (NEB #T2010S) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 1 µg of total RNA used for sequencing library construction with NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). Raw FastQ files were mapped using Bbsplit from the Bbtools 39.01 suite against Mm10 and hg38 (31 ...
-
bioRxiv - Cell Biology 2024Quote: ... The Tg-FLAG gene was then amplified and assembled with an empty pcDNA5/FRT expression vector using a HiFi DNA assembly kit (New England BioLabs, E2621). This plasmid then underwent site-directed mutagenesis to produce pcDNA5-C1264R-Tg-FLAG ...
-
bioRxiv - Microbiology 2024Quote: RdnE proteins were produced using the New England Biolabs PURExpress In Vitro Protein Synthesis Kit (New England BioLabs Inc., Ipswich MA). Template DNA contained the rdnE gene and required elements specified by the PURExpress kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA sequencing libraries were generated using the poly-A selection module in the NEBNext UltraII Directional RNA Library Prep Kit (NEB E7760) and sequenced on the Illumina HiSeq 2500 sequencer with single-end 50 cycles ...
-
bioRxiv - Cancer Biology 2024Quote: ... Assembly reaction was performed at 1:2 vector: insert ratio using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs #E5520) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: RNA encoding indicated HSP90B1 nascent chains were prepared from PCR amplified and purified DNA template containing a T7 promoter and carried out at 37°C for 2 hours using the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2024Quote: ... Adaptor-ligated DNA fragments of proper size were enriched with PCR reaction using Phusion High-Fidelity PCR Master Mix kit (NEB, M0531S) and specific index primers supplied in NEBNext Multiplex Oligo Kit for Illumina (Index Primer Set 1 ...
-
bioRxiv - Cell Biology 2024Quote: The deadenylase dead mutation (D1020A) in PAN2’s coding sequence was generated by site-directed mutagenesis (Q5 Site Directed Mutagenesis Kit from NEB E0554) with primer pairs 5’ GGTTTGAATAATGCCTTCAAACACATTAATATTAATGTC 3’ and 5’ ATGACCAACAAATACATTATTCAAACCATGACCAAC 3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA isolation module for samples with RINs greater than 7 and libraries were prepared using the NEBNext Ultra II directional RNA library preparation kit (NEB, E7760). QC was then performed on these libraries using an Agilent Bioanalyzer 2100 and the libraries were quantified using fluorometric methods ...
-
bioRxiv - Bioengineering 2024Quote: Samples were resuspended in 5 µl 1X NEBNext Cell Lysis Buffer of the NEBNext Single Cell/Low Input RNA Library Prep Kit (NEB, E6420). After 5 min incubation at RT ...
-
bioRxiv - Biochemistry 2024Quote: Active site mutations of PqqU were generated from the plasmid template pBAD24-pqqU using the Q5® Site-Directed Mutagenesis Kit (New England BioLabs) according to the manufacturer’s instructions ...