Labshake search
Citations for New England Biolabs :
8401 - 8450 of 9425 citations for Mouse Plectin PLEC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The purified T7 PCR products were confirmed by sequencing and transcribed into dsRNA using the T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA). The dsRNA produced was purified via ethanol precipitation ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA-seq libraries were prepared from 150 ng total RNA using NEBNext® Ultra™ II Directional RNA library Prep Kit for Illumina (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA-seq libraries were prepared from 500 ng total RNA using the NEBNext® Ultra™ II directional RNA library Prep Kit for Illumina (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... barcoded libraries with a targeted insert size of 480 bp were prepared using the NEBNext Ultra II DNA Library Prep Kit (E7645L, New England Biolabs, Ipswich, MA) and sequenced on a HiSeq 2500 using a 2×125 bp paired-end protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Barcoded libraries with a mean insert size of 480 bp were prepared using the NEBNext Ultra II DNA Library Prep Kit (E7645L, New England Biolabs, Ipswich, MA) and sequenced on a HiSeq 2500 using a 2 x 125 bp paired-end protocol.
-
bioRxiv - Neuroscience 2020Quote: ... was used in the preparation of sequencing libraries using the NEB Ultra II Directional RNA Library Prep Kit (NEB catalogue number E7760), following the polyA mRNA workflow ...
-
bioRxiv - Developmental Biology 2020Quote: ... The sgRNAs were synthesised by in vitro transcription using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA). Cas9 mRNA was prepared by in vitro transcription with the mMESSAGE mMACHINE T3 Transcription Kit (Life Technologies ...
-
bioRxiv - Genomics 2020Quote: ... to a final volume of 25 μl for Illumina library preparation using the NEBNext ultra II DNA library prep kit for Illumina (New England Biolabs, UK; E7645). Following 7 cycles of PCR enrichment ...
-
bioRxiv - Microbiology 2022Quote: ... The sequencing library for total RNA-sequencing was prepared using NEB Next Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Cat# E7530). Paired-end ...
-
bioRxiv - Plant Biology 2022Quote: ... Subsequent library preparation was performed with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2022Quote: ... RAD-seq library preparation was performed with the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, Massachusetts, USA) with the PstI restriction enzyme ...
-
bioRxiv - Genomics 2022Quote: Libraries were prepared using the NEBNext® Ultra DNA Library Preparation Kit for NovaSeq and NEBNext® Ultra II FS DNA Library Preparation Kit for MiSeq sequencing following the manufacturer’s recommendations (New England Biolabs, Ipswich, MA). For the validation experiments ...
-
bioRxiv - Systems Biology 2022Quote: ... strand-specific total-transcriptome RNA sequencing libraries were prepared by incorporating dUTPs in the second-strand synthesis step with NEB Next® UltraTM Directional RNA Library Prep Kit for Illumina® (NEB). Finally ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNAs were subjected to sequencing library construction using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB, E7645L), and were deep sequenced on a NextSeq 550 platform using 40nt/40nt pair-ended mode ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA synthesis was performed from 1 µg total RNA using the ProtoScript® First Strand cDNA Synthesis Kit (New England Biolabs, NEB) with the provided random primer mix according to the suppliers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... was used to remove rRNA from Escherichia coli total RNA and RNA-seq libraries were constructed using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, USA E7760L). Libraries were recovered with AMPure XP beads A63880 (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was generated from 1 μg of total RNA using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, #E6560).
-
bioRxiv - Molecular Biology 2020Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (E7770S, New England Biolabs, Ipswich, MA). Briefly ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mutants selected for cloning were also analysed via T7 endonuclease I-based (T7E1) heteroduplex assay according to the manufacturers protocol (EnGen® Mutation Detection Kit, NEB #E3321), and the length of digested and undigested fragments were visually compared by gel electrophoresis (Fig ...
-
bioRxiv - Molecular Biology 2021Quote: ... Input and CHART-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB) according to kit instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The final pool was run on an Agilent Bioanalyzer dsDNA High Sensitivity chip and quantified using NEBNext Library Quant Kit for Illumina (cat # E7630L, New England Biolabs, Ipswich, USA).”
-
bioRxiv - Molecular Biology 2021Quote: ... mRNA-Seq libraries were prepared from total RNA using the NEBNext Ultra II Directional RNA-Seq Kit (NEW ENGLAND BioLabs, Inc., UK). The isolation of mRNA was performed using the Poly(A ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was checked on a fragment analyzer and 50 ng was used for library preparation with the NEBNext® Ultra™ II DNA Library Prep Kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sonicated DNA was subjected to end-repair and adapter ligation using the NEBNext® Ultra™ II DNA Library Prep Kit (NEB) following the NEB protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sequencing libraries were prepared by using 10 ng of purified DNA (averaged size 250-300 bp) with the NEBNext® Ultra™ II Library Prep Kit for Illumina (New England Biolabs) using the application note for “Low input ChIP-seq.” ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were constructed using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760, New England BioLabs, Ipswich, MA). The library preps were started with 92-1000 ng of total RNA ...
-
bioRxiv - Genomics 2019Quote: ... were used to PCR amplify both wild type and RRM3 Mt cDNA inserts for ligation into a pET28b vector containing an N-terminal 10xHis-SUMO tag using the Quick Ligation kit (NEB, Ipswich, MA). Plasmids containing the cDNA of interest were verified by Sanger sequencing prior to expression (Quintara Biosciences ...
-
bioRxiv - Genomics 2020Quote: ... In vitro transcription was done using the HiScribe T7 High Yield RNA Synthesis Kit according to the manufacturer’s instructions (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Genomics 2020Quote: ... a library without the enrichment method was also processed using NEBNext® Ultra™ II FS DNA Library Prep kit following the manufacturer’s recommendations (New England Biolabs, USA). The library preparation for D ...
-
bioRxiv - Microbiology 2019Quote: ... and also quantified using NEB Luna Universal qPCR Master Mix and Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA) for qPCR and RT-qPCR test ...
-
bioRxiv - Molecular Biology 2019Quote: M6A and m1A immunoprecipitationwere adapted from the protocols provided in the EpiMark® N6-Methyladenosine Enrichment Kit (NEB #E1610S, New England BioLabs Inc) and that previously described (28) ...
-
bioRxiv - Physiology 2020Quote: RNA was extracted from cultured cells or tissue (∼10 mg) stored in RNALater® using Monarch® Total RNA Miniprep Kit (New England BioLabs). For maximal RNA recovery ...
-
bioRxiv - Molecular Biology 2020Quote: ... dsDNA templates were then in vitro transcribed using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA) using overnight incubation as described in the protocol for <0.3kb transcripts.(28 ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and quantified by qPCR on a Bio-Rad CFX Connect Real-Time PCR detection system with the NEBNext Library Quant Kit for Illumina (New England Biolabs, catalog # E7630L). The libraries were normalized to 10 nM ...
-
bioRxiv - Microbiology 2019Quote: ... and 7 cycles of PCR to enrich for ligated product was done with NEBNext® Ultra™ DNA Library Prep Kit for Illumina (New England Biolabs). Libraries were quantitated with KAPA Library Quantification Kits for Next-Generation Sequencing (Roche Sequencing Solutions ...
-
bioRxiv - Systems Biology 2019Quote: ... Adapters were ligated to FAIRE DNA (300 ng) using NEBNext® Ultra™ II DNA Library Prep Kit (NEB Catalog No. E7645S). After U excision step ...
-
bioRxiv - Biophysics 2019Quote: ... HIV-1 MAG2A-ΔHBR-EGFP was generated from HIV-1 MAG2A-EGFP by deleting amino acids 18-32 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA). pEGFP-N1 and pEYFP-N1 were obtained from Clonetech (Mountainview ...
-
bioRxiv - Molecular Biology 2020Quote: ... 70 ng genomic DNA was used to prepare paired-end libraries with the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs, Ipswich, MA) using only 10% of the reagents recommended in the original protocol of the supplier ...
-
bioRxiv - Physiology 2019Quote: PCR templates generated as described above (see Table S3) were used for in vitro transcription reactions using the HiScribe T7 RNA Synthesis Kit (New England Biolabs, Whitby, ON) following the recommended conditions when using modified nucleotides ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the NGS libraries were created from mRNA isolated using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NewEngland BioLabs, Ipswich, Massachusetts). Final libraries were sequenced on a Illumina NextSeq 500 on a high output flowcell with 2×75 bp paired-end read lengths.
-
bioRxiv - Microbiology 2019Quote: Illumina paired-end sequencing libraries were prepared from genomic DNA using the NEBNext® Ultra™ DNA Library Prep Kit according to the manufacturer’s protocol (New England Biolabs, UK) and sequenced by standard procedures on the Illumina MiSeq platform ...
-
bioRxiv - Plant Biology 2019Quote: ... Three different biological replicates represented by total RNA extracted from three individual plants and reverse transcribed into cDNA by LunaScript®RT SuperMix Kit (New England Biolabs Inc.) were used for statistical analysis of the quantification ...
-
bioRxiv - Microbiology 2019Quote: ... 10 (GSF1697) or 12 (GSF2248) PCR cycles were run using 8-nt barcoded oligos from NEBNext Multiplex Oligos barcode kit (NEB cat# 6609S). The libraries were purified with Agencourt AMPure XP beads ...
-
bioRxiv - Microbiology 2019Quote: ... 30 and 100 days were fragmented into ∼150 bp segments and prepared for sequencing using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina in combination with the NEBNext Multiplex Oligos for Illumina (New England BioLabs, Ipswich, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2019Quote: ... the CggR mutant variant R250A was inserted in the above generated plasmids (replacing the CggR wt) using the NEB Gibson assembly kit (New England Biolabs, MA, US). 5 µl of reaction mix was transformed into chemical competent E ...
-
bioRxiv - Molecular Biology 2021Quote: ... and final RNA-seq libraries generated using the NEBNext Ultra II Directional RNA Library Prep kit (NEB, E7760 and NEBNext Multiplex Oligos (NEB, E7335/E7500). Final libraries were sequenced as 150 bp paired-end reads on the Illumina HiSeq platform.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA was extracted with a standard TRIzol RNA extraction and chloroform/isopropanol precipitation and cDNA was prepared with the ProtoScript II First Strand cDNA synthesis kit (New England Biolabs, Frankfurt, Germany). For each sample ...
-
bioRxiv - Microbiology 2020Quote: ... The sequencing library was prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs; Ipswich, Massachusetts, USA) and was sequenced on a single lane of a HiSeq 2500 (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Library preparations were performed using the NEBNext Ultra II DNA Library Prep Kit for Illumina with the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB, Ipswich, Massachusetts). Library preparation followed the protocol outlined in Saeidi et al ...