Labshake search
Citations for New England Biolabs :
8401 - 8450 of 9715 citations for Human Transcription factor HIVEP2 HIVEP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The WT PACT expression vector was used as template for constructing p38 mutant PACT clone by using Q5 site-directed mutagenesis kit (New England Biolabs, E0554S). Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted from zebra finch and chicken embryos using QIAgen RNeasy kit and transcribed into cDNA using LunaScript RT (NEB #E3010). PCR was performed using chicken or zebra finch cDNA and gene specific primers (Supplemental table 33) ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was prepared with 0.1-1 µg of total RNA using the Protoscript First Strand cDNA Synthesis kit (New England Biolabs; Catalogue #E6560L) as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A clean-up step was performed using Qiagen MinElute PCR purification kit and PCR-amplified using NEBNext Ultra Q5 DNA polymerase master mix (New England Biolabs®) with forward primer (5’-TAGAGCATGCACC GGCAAGCAGAAGACGGCATACGAGAT[N10]ATGTCTCGTGGGCTCGGAGATGT-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA Magnetic Isolation Module (E7490L) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Developmental Biology 2024Quote: ... and PCR amplification to prepare cDNA libraries using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, USA). Library preparation and next-generation sequencing were outsourced to Rhelixa Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... was synthesized from 300 ng to 1 μg of total RNA using a NEB ProtoScript II first strand cDNA synthesis kit (NEB, E6560). For RNA-sequencing ...
-
bioRxiv - Genomics 2024Quote: ... The digest product was run on a 1% agarose gel and the band was excised and purified using a Monarch DNA Gel Extraction Kit (NEB #T1020) following the manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... DNA libraries for Next Generation Sequencing were prepared with NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs E7775) and NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1 ...
-
bioRxiv - Genomics 2023Quote: ... was extracted from hTERT RPE-1 dry cell pellets using the Monarch HMW DNA extraction kit for cells & blood (New England Biolabs, NEB T3050L) and for tissue (NEB T3060L) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... four sequencing libraries were generated by NEBNext® Ultra ™II DNA Library Prep Kit for Illumina ® (NEB, Ipswich, MA). Sizes and concentrations of the sequencing libraries were again verified by the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Genomics 2024Quote: ... amplification of the target USH2A region using gDNA of a human heterozygous USH2A:c.7595-2144A/G patient and subsequent cloning into the pSPL3 backbone vector by NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs). The intronic sequence encompassing the USH2A:c.7595-2144 location was introduced in the recipient pSPL3 exon trapping vector ...
-
bioRxiv - Genomics 2024Quote: ... libraries were prepared in quadruplicate from 1ug DNA using the NEBNext® Ultra II ligation kit (New England Biolabs, Ipswitch, MA) according to the manufacturer’s protocols ...
-
bioRxiv - Genomics 2024Quote: ... after which the RNA probes were purified using the Monarch® RNA Cleanup kit (50 µg) (New England Biolabs, Ipswitch, MA). Finally ...
-
bioRxiv - Genomics 2024Quote: ... IVT reactions were set up in 30 μl total volume with the HiScribe T7 High Yield RNA Synthesis Kit (NEB E2040S) with 2 μl of each NTP ...
-
bioRxiv - Genomics 2024Quote: ... 2 µg genomic DNA was used to construct a sequencing library following the manufacturer’s instructions using NEBNext Ultra DNA Library Prep Kit (NEB Inc., America). Paired-end sequencing libraries with an insert size of approximately 400 bp were sequenced on an Illumina HiSeq 4000 sequencer ...
-
bioRxiv - Microbiology 2024Quote: ... We then assembled the digested backbone with the mutagenized GPC inserts with NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621) at a 1:2 vector to insert ratio for a 1 hr reaction ...
-
bioRxiv - Microbiology 2024Quote: ... A fragment containing the CRISPR array plus the extra BsrG1 restriction site was cut from the synthesized pUC19 by digestion with DraI and BstZ17I enzymes and cloned into the BsaI-linearized pSTU-1 plasmid using the NEBuilder HiFi cloning kit (New England Biolabs, UK). The plasmid sequence was confirmed by sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: Approximately 40mg of feces were used for RNA extraction using the Monarch® Total RNA Miniprep Kit (New England Biolabs, NEB) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Sample preparation was performed according to the protocol “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (NEB #E7760S/L). Briefly ...
-
bioRxiv - Immunology 2024Quote: ... or a low input method using NEB Next® Ultra RNA Library Prep Kit for Illumina® (NEB, Cat. No. 7530). First-strand cDNA synthesis and tailing by reverse transcription were performed using SMART (Switching Mechanism at 5’ End of RNA Template ...
-
bioRxiv - Biochemistry 2023Quote: jAspSnFR3 and jAspSnFR3-mRuby3 were first cloned into entry vector pENTR1A (Fisher, A10462) using NEBuilder HiFI DNA Assembly Cloning Kit (New England BioLabs, E2621). These donor constructs were then used to transfer their insert into destination vectors ...
-
bioRxiv - Physiology 2023Quote: ... were PCR-amplified from wild-type N2 gDNA and subcloned into the SpeI and NheI sites of a pL4440 expression vector with NEBuilder® HiFi DNA Assembly Cloning Kit (E2621L, NEB). Briefly ...
-
bioRxiv - Biochemistry 2024Quote: ... library indexing was carried out with the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, Cat. E7645S) and sequenced on a NextSeq 1000 P2 cartridge (Illumina ...
-
bioRxiv - Bioengineering 2024Quote: High Molecular Weight (HMW) DNA was obtained using the Monarch® HMW DNA extraction kit for Tissue (T3060L, New England Biolabs), as previously described (Low et al ...
-
bioRxiv - Bioengineering 2024Quote: ... The bacterial pellet was then resuspended in 1X DNA/RNA protection reagent supplied with the Monarch Total RNA Miniprep Kit (NEB #T2010) (New England BioLabs ...
-
bioRxiv - Bioengineering 2024Quote: cDNA of each library was generated using oAS345 (Supplemtary Note 21) and LunaScript Primer-Free RT Master Mix Kit (NEB E3025S).
-
bioRxiv - Bioengineering 2024Quote: ... The bacterial pellet was then resuspended in 1X DNA/RNA protection reagent supplied with the Monarch Total RNA Miniprep Kit (NEB #T2010) (New England BioLabs, USA) and subjected to mechanical lysis using the FastPrep-24™ 5G bead beating grinder system (MP Biomedicals Germany GmbH) ...
-
bioRxiv - Cell Biology 2024Quote: ChIP-seq libraries were prepared independently from two ChIP biological replicates using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, #E6177L) according to manufacturer’s instructions with a few modifications ...
-
bioRxiv - Cancer Biology 2024Quote: DNA was extracted from lentiviral transduced cells using the Monarch® Genomic DNA Purification Kit (New England Biolabs, Ipswich, MA, USA), and its quality was determined using the NanoDrop Q500 spectrophotometer (Quawell CF ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs, no. E7775) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Whole exome library construction was generated using the NEB Next® Ultra RNA Library Prep Kit for Illumina (E7530L, NEB, USA) after DNA shearing ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 ng of purified CUT&RUN enriched DNA was used to prepare Illumina library using the NEBNext Ultra II DNA Library Prep kit (NEB, #E76450) per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... These gene fragments were cloned into pcDNA3.1-PsChR2-eYFP backbone vector using the HiFi Assembly Kit (New England Biolabs, lpswich, MA).
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-sequencing libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep kit for Illumina® (NEB) following supplier’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... The amplified fragment containing SNAP was assembled with an amplified pUbq destination backbone using a NEBuilder® HiFi DNA Assembly kit (NEB) to create a pUbq-SNAP destination vector ...
-
bioRxiv - Cell Biology 2024Quote: ... The pRNA destination backbone was linearised by primers s5 and s6 (Table 3) and assembled with the mScarlet-I3 fragment using a NEBuilder® HiFi DNA Assembly kit (NEB) to create a pRNA-mScarlet-I3 destination vector ...
-
bioRxiv - Microbiology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) using 200-600ng total RNA as input ...
-
bioRxiv - Microbiology 2023Quote: ... following the manufacturer’s protocol and cDNA library preparation using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Massachusetts, USA). DNA library quality control was done by measuring concentration using the Qubit 2.0 fluorometer (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... libraries were constructed with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (catalog no. E7760L, NEB) and indexed with NEBNext® Multiplex Oligos for Illumina (catalog no ...
-
bioRxiv - Molecular Biology 2023Quote: ... the same amount of input RNA was loaded for library preparation using the NEBNext Multiplex Small RNA library preparation kit (New England Biolabs, USA). Libraries were size-selected for fragments 15-50 bp by gel electrophoresis ...
-
bioRxiv - Genomics 2023Quote: ... and strand-specific sequencing libraries were made using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, E7760S) with eight cycles of amplification ...
-
bioRxiv - Microbiology 2023Quote: ... Pooled genomic DNA samples were used to sequence libraries constructed using the NEBNext Ultra II Library Prep Kit (NEB, Ipswich, USA). Paired-end metagenomics sequencing was performed on an Illumina NextSeq 550 sequencer using NextSeq High Output Kit v2 sequencing reagent kit ...
-
bioRxiv - Microbiology 2023Quote: ... 300 bp-insert RNA-seq Illumina libraries were constructed using ∼1.0 μg of enriched mRNA that was fragmented then used for synthesis of strand-specific cDNA using the NEBnext Ultra Directional RNA Library Prep Kit (NEB-E7420L). The cDNA was purified between enzymatic reactions and the size selection of the library performed with AMPure SpriSelect Beads (Beckman Coulter Genomics) ...
-
bioRxiv - Immunology 2023Quote: ... DNA was extracted from 10ng of mouse brain tissue as previously described13 using NEB Monarch High molecular weight DNA extraction kit according to manufacturer’s instructions (NEB Cat #T3050).
-
bioRxiv - Cell Biology 2023Quote: Libraries were prepared on an automated liquid handler (Biomek i7) using the NEBNext Ultra II DNA library preparation kit (NEB, E7645), according to the manufacturer’s instructions and without size selection ...
-
bioRxiv - Genomics 2023Quote: ... Paired-end libraries were constructed using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs, E7645S) using a starting material of 50 ng ...
-
bioRxiv - Molecular Biology 2023Quote: ... with primers listed in Table S8, then inserted into PHR-mCh- CryWT plasmid (Adgene, 101221) by using NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520S). The generated constructs were fully sequenced to confirm the absence of any mutations or stop codons ...
-
bioRxiv - Microbiology 2023Quote: ... dual unique indexed libraries for sequencing on all Illumina platforms were made using the NEBNext Ultra™ II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Manufacturer protocol was modified by diluting adapter 1:30 and using 3 μl of this dilution ...
-
bioRxiv - Microbiology 2023Quote: Libraries for RNAseq were prepared using the NEB Next Ultra II Directional RNA Library Prep Kit (New England Biolabs, Ipswich, MA). Individual libraries were uniquely barcoded with NEBNext Multiplex Oligos for Illumina sequencing platform (New England Biolabs ...