Labshake search
Citations for New England Biolabs :
8201 - 8250 of 9358 citations for Rat Leptin RIA kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... of extracted RNA (either from whole-cell lysates or sucrose gradient fractions) was performed using the ProtoScript II First Strand cDNA Synthesis Kit (NEB E6560L) according to the manufacturer instructions with some modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... was used to construct sequencing libraries using the NEBNext Ultra II DNA library preparation kit for Illumina (New England Biolabs; #E7760). Libraries were multiplexed using NEBNext Multiplex Oligos for Illumina (dual index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... W165F and S169A) were introduced into human PSEN1 cDNA cloned into the pMSCVpuro vector using Q5 Site-Directed Mutagenesis Kit (NEB BioLabs) according to the standard protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The gene of the mCherry fluorescent protein was inserted into the pHERD20T plasmid according to the manufacturer’s protocol of NEBuilder® HiFi DNA Assembly kit (New England Biolabs, UK). The resulting plasmid was named pHERDmCh ...
-
bioRxiv - Molecular Biology 2023Quote: ... In vitro mutagenesis was carried out with the Q5 site-directed mutagenesis kit (Cat. No. E0554S, New England Biolabs, Ipswich, MA). Primers specific for the desired mutations were designed with the NEBaseChanger on the NEB website ...
-
Critical contribution of mitochondria in the development of cardiomyopathy linked to desmin mutationbioRxiv - Pathology 2023Quote: ... prior to mRNA library preparation using the Single Cell/Low Input RNA Library Prep Kit for Illumina® (New England Biolabs). Libraries were sequenced on an Illumina HiSeq 2500 V4 system ...
-
bioRxiv - Neuroscience 2023Quote: ... All the libraries were prepared together using the NEBNext® Ultra™ II RNA Library Prep Kit (New England BioLabs Inc.) as per the manufacturer’s protocol within one sitting ...
-
bioRxiv - Genetics 2023Quote: ... 1ug of RNA was used to synthesize cDNA using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB Cat #E6560L). 50ng of cDNA was used to perform qPCR with PowerUp SYBR Green Master Mix (ThermoFisher Cat # A25741) ...
-
bioRxiv - Genetics 2023Quote: ... Post rRNA removal samples were prepared for either Illumina or Singular Sequencing using NEBNext Ultra II RNA Library Prep Kit for Illumina with Beads (NEB#E7775). Singular specific primers for the libraries sequencing on Singular which had the S1/S2 handles instead of Illumina’s p7/p5 handles.
-
bioRxiv - Genetics 2023Quote: ... were carried out with 3 nM of each DNA fragment from the master mix and 2 µL of the NEBridge Golden Gate Assembly Kit (BsaI-HFv2) (NEB E1601S) in 1X T4 DNA ligase Reaction Buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... was synthesized from 300 ng to 1 μg of total RNA using a NEB ProtoScript II first strand cDNA synthesis kit (NEB, E6560). The sequences of the primers used for RT-PCR are listed in Table S2.
-
bioRxiv - Immunology 2023Quote: ... Base editors were cloned into the IVT template vector using NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs, #E5520S) (Extended Data Table 5 ...
-
bioRxiv - Microbiology 2023Quote: RNA extracts from WWI were prepared for RNA sequencing using the NEB Ultra II RNA Sequencing kit (New England Biolabs, E7770S), following manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... was end repaired and adapters were ligated to it following the procedure of the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645S), purified using AMPure XP beads and eluted in 50 μL of H2O ...
-
bioRxiv - Microbiology 2023Quote: RNA extracts from WWI samples were reverse transcribed to synthesize cDNA using the LunaScript SuperMix RT kit (New England Biolabs, E3010L); 10 µL of each RNA extract was used in a total reaction volume of 20 µL ...
-
bioRxiv - Genomics 2023Quote: Mouse tail (1cm) was used to extract the genomic DNA (gDNA) using NEB Monarch® Genomic DNA Purification Kit (NEB T3010L). DNA concentration was measured on Qubit dsDNA BR assay kit (cat ...
-
bioRxiv - Immunology 2023Quote: Immunoglobulin libraries were generated from 1 μg of RNA using the NEBNext Immune Sequencing Kit (New England Biolabs, Ipswich, Massachusetts, USA) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and then prepared into a whole-genome shotgun library using the NEB Ultra Library Prep kit (New England Biolabs; Ipswich, MA). Instead of the standard Illumina library prep adaptor ...
-
bioRxiv - Genomics 2023Quote: ... and day 14 post-transfection and genomic DNA (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England Biolabs, T3010L). Target regions were amplified by PCR to add barcodes for multiplexing ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted from three pooled killing assay spots (as detailed in the previous section) utilizing the Monarch® Genomic DNA Purification Kit (NEB). Quantification of genomic DNA copies was targeted at the kdpAB gene and carried out with the Naica® Crystal Digital PCR System using Sapphire chips (Stilla Technologies).
-
bioRxiv - Immunology 2023Quote: Total RNA was extracted from 107 hybridoma cells using the MonarchTM total RNA extraction kit (New England BioLabs, Ipswich, MA, USA) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... adaptor ligation and PCR indexing was performed on the denatured amplicons using NEB Next Ultra II DNA library prep kit for Illumina (New England Biolabs, UK). The resulting FASTQ files from RNP treated samples for each of the off target amplicons were analysed for indels through CRISPResso2 webtool [45] by comparing them with untreated samples.
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting fragment was then inserted into XhoI and NdeI digested pET21a vector by NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520). As a result ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP libraries were generated with input and pulldown DNA using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB E7645L) for sequencing on an Illumina Nextseq with 75-bp read length and single-end.
-
bioRxiv - Microbiology 2023Quote: ... The NGS library preparation was carried out using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB, USA), which performs fragmentation ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then <5 ng ChIP sample DNA or <20 ng input DNA was used for sequencing libraries using the NEB Next Ultra II DNA Library Prep Kit for Illumina (New England BioLabs, E7645). In Step 1.3 (End Prep) ...
-
bioRxiv - Cell Biology 2023Quote: ... a PCR fragment containing the complete Nv-osk coding sequence was synthesized for protein expression with PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs) using manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the mCherry-SopF coding sequence was cloned into the pPB Piggybac plasmid (Vectorbuilder) using the NEB HIFI DNA Assembly Kit (NEB, E2621L).
-
bioRxiv - Cell Biology 2023Quote: ... RNA-Seq libraries were prepared with NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext® UltraTMII Directional RNA Library Prep Kit (New England Biolabs). Libraries were sequenced using the NovaSeq 6000 system (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacturer’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Cell Biology 2023Quote: ... These fragments were combined using a the NEBuilder Hi-Fi DNA assembly kit according to the manufacture’s instructions (E5520, New England BioLabs, Waltham, MA). The resulting product was transformed into then transformed into competent cells (C2987 ...
-
bioRxiv - Cell Biology 2023Quote: ... The C-KSR-GS construct replacing the vector-based linker (LELKLRILQS) by a glycine-serine rich linker (GGSSGGGGA) was generated by site directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, NEB, USA) of the C-KSR-EGFP plasmid ...
-
bioRxiv - Cell Biology 2023Quote: Capped mRNAs with poly-A tail were synthesized from linearized pGEMHE plasmids using the HiScribe™ T7 ARCA mRNA Kit (NEB). The mRNA was purified by Monarch RNA Cleanup Kit (NEB) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... USA) to enable miniaturized library preparation with the NEBNext Ultra II RNA Library Prep Kit (New England Biolabs, Beverly, MA, USA). Library preparation was performed per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... the tissue samples were stained using Vizgen’s Cell Boundary Kit (Vizgen, 10400009) and blocked in blocking solution (Vizgen, 20300012) supplemented with a 1:20 dilution of Rnase inhibitor (NEB, M0314L) for one hour ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA synthesis and qRT-PCR were performed in a one-pot reaction using Luna® Universal One-Step RT-qPCR Kit (NEB). A QuantStudio Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Developmental Biology 2023Quote: Libraries for RNA sequencing were generated using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB #E6420) in conjunction with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Cell Biology 2023Quote: ... the efficiency of each sgRNA (sg1 to sg5) was verified by extracting genomic DNA (Monarch Genomic DNA Purification Kit, NEB T3010S) and PCR-amplifying the region of the gene targeted by each sgRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown out in LB medium with 50 µg/mL Kanamycin and then pelleted before plasmids were isolated using the Monarch Plasmid Miniprep Kit (NEB, T1010L). Plasmids were sequenced (Sanger ...
-
bioRxiv - Molecular Biology 2023Quote: ... The specimens were then incubated with a 20-fold diluted Quick Ligase in 1x Quick Ligase Reaction Buffer from Quick Ligation Kit (New England Biolabs, M2200), supplemented with an additional 1 mM ATP (TAKARA Bio ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... downstream of the constitutive 35S promoter and upstream of the start codon of the GUS reporter using HiFi DNA assembly cloning kit (NEB E5520). Fragments of 35S promoter + vector backbone + GUS was amplified using forward primer ATGTTACGTCCTGTAGAAACCC and reverse primer GTCGACTCCAAATGAAATGAAC ...
-
bioRxiv - Developmental Biology 2024Quote: ... three sgRNAs for skp2 were designed and synthesized in vitro using HiScribe™ T7 High Yield RNA Synthesis Kit(NEB, E2040S). The Cas9-sgRNA ribonucleoprotein complex (RNP ...
-
bioRxiv - Genomics 2024Quote: ... Zirconium beads (3.0mm) in a bead beater were used to homogenize mosquitoes before proceeding with NEB Monarch Total RNA Miniprep Kit (NEB #T2010). The on-column DNase I treatment was performed during RNA extraction ...
-
A humoral immune response to parasitoid wasps in Drosophila is regulated by JAK/STAT, NF-κB and GATAbioRxiv - Immunology 2024Quote: ... RNAseq libraries were then prepared using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs #E7760S) with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs ...
-
bioRxiv - Genetics 2024Quote: ... TLK1 and TLK2 point mutants were generated by site-directed mutagenesis reactions using the NEB Q5 site-directed mutagenesis kit (NEB, E0554S). Primers are listed in Supplementary Table 1.
-
bioRxiv - Pathology 2024Quote: Sequencing library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs, MA). cDNA libraries were sequenced by a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genetics 2024Quote: ... and 0.5–50 ng of DNA/ChIP was used for library preparation using the NEBNext Ultra II DNA Library Kit for Illumina (NEB E7645) and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of RNA was used as input for library preparation using the NEBNext Multiplex Small RNA Library Prep Kit for Illumina (NEB E7560S), according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... The spheres were collected after 24 h and RNA extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs #T2010S). RNA was extracted from adherent cells directly from the plate ...