Labshake search
Citations for New England Biolabs :
8151 - 8200 of 9547 citations for QuantiChrom Phosphate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Two to three PCR reactions per sample were combined and cleaned-up using the Monarch PCR and DNA clean-up kit (NEB, T1030S). 10-100 ng of DNA from each sample was carried forward for end-repair using the NEBNext Ultra II End repair/dA-tailing Module (NEB ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, Cat. No. / ID: E7770) following the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc, Ipswich, Massachusetts, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Barcoded stranded mRNA-seq libraries were prepared from 300 ng of high-quality total RNA samples using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Plant Biology 2024Quote: A spike-in Luciferase RNA was first transcribed in vitro using HiScribe™ T7 Quick High Yield RNA Synthesis Kit (New England Biolabs) according to Manufacturer’s instructions ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... RNA library preparation was performed using the NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® (NEB #E7775) or the SMRTbell Prep Kit 3.0 for Illumina and Iso-Seq respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... and prepared using NEBNext Ultra II Directional RNA Library Prep Kit with Sample Purification Beads (E7765; New England Biolabs, Ipswitch, MA). cDNA libraries were then indexed using the NEBNext Dual Index Kit (E7600S ...
-
bioRxiv - Neuroscience 2024Quote: ... using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Neuroscience 2024Quote: ... and 100 ng of RNA was reverse-transcribed into cDNA using the LunaScript RT Master Mix Kit (New England Biolabs #E3025L). qPCR reactions utilized specific primers and were performed in triplicate with Applied Biosystems TaqMan Gene Expression Master Mix (ThermoFisher #4369016) ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR reactions were carried out in 10 μL reactions using the Luna® One-Step Universal RT-qPCR kit (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA was quality checked using Bioanalyser (RIN>9) and libraries generated using NEBNext Ultra II Library Prep Kit (NEB, E7770) as per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: EM-seq libraries were prepared from genomic DNA as previously (78) using the NEB Enzymatic Methyl-seq kit (New England BioLabs; P7120L). In brief ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Purification of PCR products for downstream applications was accomplished using either phenol/chloroform ethanol precipitation or the Monarch® PCR & DNA Cleanup Kit (New England Biolabs) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... The directional RNA-seq libraries were constructed using the NEBNext Ultra II Directional RNA Library prep for Illumina kit (NEB, E7760L) utilising the NEBNext Poly(A ...
-
bioRxiv - Plant Biology 2024Quote: cDNA libraries with different insert sizes were constructed using the NEB Next Ultra TM Directional RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations and were assessed on an Agilent Bioanalyzer 2100 system ...
-
bioRxiv - Immunology 2024Quote: Sequencing: Poly A-enriched libraries were made using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, cat. E7770) and sequenced on a NovaSeq SP with PE150 read length.
-
bioRxiv - Cell Biology 2024Quote: ... Purified RNAs were used for Illumina RNA-seq library preparation with NEBNext Ultra II Directional RNA Library Prep Kit (NEB, E7765), and a minimum of 20 million raw reads were obtained ...
-
bioRxiv - Systems Biology 2024Quote: ... Approximately 100 ng of each DNA sample was used to create Illumina sequencing libraries using a NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs (NEB), E7805S) ...
-
bioRxiv - Physiology 2024Quote: ... High-quality RNA samples were used to construct sequencing libraries with NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA), and the libraries were sequenced using Illumina HiSeq X ten/NovaSeq 6000 system (2 × 150 bp read length ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from starter cultures of the three original ancestor isolates and 10 trimethoprim-resistant derivatives using New England Biolabs Monarch Genomic DNA Extraction Kit (New England Biolabs, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and used to generate sequencing libraries using the NEBNext Ultra II FS Library Prep kit (New England Biolabs, Ipswich, MA, USA), followed by sequencing on the Illumina MiSeq platform to generate 250 bp paired end reads ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 ng of total RNA from each sample was used for preparing the libraries with the NEBNext Ultra II Directional RNA Library Prep kit (New England Biolabs, #E7760), using the rRNA depletion module ...
-
bioRxiv - Genetics 2024Quote: ... gcry1:BFP vector backbone was assembled with the 2A and nCas9n PCR amplicons using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB # E5520S) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing libraries for ribosome profiling were prepared following the NEBNext Multiplex Small RNA Library Prep kit for Illumina’s protocol (NEB, Cat# E7300S). Ribo-seq ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries for small DNA fragments (25-75 bp) were prepared based on the NEBNext Ultra II DNA library prep Kit for Illumina (NEB#E7645).
-
bioRxiv - Neuroscience 2024Quote: ... C terminal and αPKC binding region) or PICK1 (BAR domain) were made with NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520S). Mutations of PICK1 (KD-AA and 5K-E ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 50 ng of material was fragmented for 8 min at 37 °C and A-tailed for 30 min at 65 °C using NEBNext Ultra II FS DNA Library Prep Kit (NEB, E7805S). The fragmented and dA-tailed DNA library was ligated to dsDNA adapter having both forward (Ligation FWD primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were barcoded using Illumina i5 and i7 adaptors from NEBNext® Multiplex Oligos for Illumina (Dual Index Primers Set 1) kit (New England Biolabs) and sequenced using a 150-cycle NextSeq 500/550 High Output Kit v2.5 with 75 forward and 75 reverse reads ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg of PCR product was used in an in vitro transcription reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB, E2040S) in the presence of 20units/mL SUPERaseIn ...
-
bioRxiv - Molecular Biology 2024Quote: ... was added to 500 ng total RNA then the rRNA was depleted with the NEBNext rRNA depletion kit V2 (NEB, E7400L) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... ABCA4 missense variants were introduced in WT-ABCA4-SmBiT by site-directed mutagenesis using Q5 Site-directed mutagenesis kit quick protocol (NEB, E0554) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2024Quote: RNA-seq libraries were prepared from 100 ng RNA/sample using the NEBNext Ultra II RNA library preparation kit for Illumina (NEB E7770S) in conjunction with the NEBNext poly(A ...
-
bioRxiv - Microbiology 2024Quote: Approximately 40mg of feces were used for RNA extraction using the Monarch® Total RNA Miniprep Kit (New England Biolabs, NEB) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Purified RNAs were used for Illumina RNA-seq library preparation with NEBNext Ultra II Directional RNA Library Prep Kit (NEB; E7765), and a minimum of 20 million raw reads were obtained ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA was quantified by Nanodrop and 1 µg of RNA per sample was treated for ribosomal RNA depletion using the NEBNext rRNA Depletion Kit (NEB, E6350) and then immediately followed by Library prep using NEBNext Ultra II kit (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... The samples were then centrifuged at 13000 x g for 1 minute and the supernatant was once more purified using the Monarch® PCR & DNA Cleanup Kit (New England BioLabs). We expect the “crush and soak” method to improve signal strength if low labeling densities are used during extension.
-
bioRxiv - Cell Biology 2024Quote: ... Qualified RNA samples were subjected to sequencing library construction using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, E7775). Paired-end (2 × 150 bp ...
-
bioRxiv - Biochemistry 2023Quote: ... the point mutations to synthesize AID-C12*-dCas9-BE4max and AID-C12*-n’Cas9-BE4max were generated using the Q5 Site-Directed Mutagenesis Kit (NEB, Cat #E0554S).
-
bioRxiv - Plant Biology 2023Quote: ... DNA libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (New England Biolabs) and each individual library was barcoded using the NEBNext® Multiplex Oligos for Illumina® kit (New England Biolabs).
-
bioRxiv - Cell Biology 2024Quote: ... The resulting amplicon was used as starting material for in vitro transcription using HiScribe T7 High Yield RNA Synthesis Kit (NEB, E2040S). Finally ...
-
bioRxiv - Immunology 2024Quote: ... Libraries were prepared at the according to manufacturer’s instructions for the NEBNext Ultra II Direction RNA kit (NEB, product number E7760). The resulting libraries tagged with unique dual indices were checked for size and quality using the Agilent High Sensitivity DNA Kit (Agilent) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were created using 1000ng of total RNA with the NEBNext Ultra 2 Directional RNA Library Kit following the Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) and sequenced on an Illumina Hi-Seq 2000 ...
-
bioRxiv - Cell Biology 2024Quote: ... The WT PACT expression vector was used as template for constructing p38 mutant PACT clone by using Q5 site-directed mutagenesis kit (New England Biolabs, E0554S). Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted from zebra finch and chicken embryos using QIAgen RNeasy kit and transcribed into cDNA using LunaScript RT (NEB #E3010). PCR was performed using chicken or zebra finch cDNA and gene specific primers (Supplemental table 33) ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was prepared with 0.1-1 µg of total RNA using the Protoscript First Strand cDNA Synthesis kit (New England Biolabs; Catalogue #E6560L) as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A clean-up step was performed using Qiagen MinElute PCR purification kit and PCR-amplified using NEBNext Ultra Q5 DNA polymerase master mix (New England Biolabs®) with forward primer (5’-TAGAGCATGCACC GGCAAGCAGAAGACGGCATACGAGAT[N10]ATGTCTCGTGGGCTCGGAGATGT-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA Magnetic Isolation Module (E7490L) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Developmental Biology 2024Quote: ... and PCR amplification to prepare cDNA libraries using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs, USA). Library preparation and next-generation sequencing were outsourced to Rhelixa Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... was synthesized from 300 ng to 1 μg of total RNA using a NEB ProtoScript II first strand cDNA synthesis kit (NEB, E6560). For RNA-sequencing ...
-
bioRxiv - Genomics 2024Quote: ... The digest product was run on a 1% agarose gel and the band was excised and purified using a Monarch DNA Gel Extraction Kit (NEB #T1020) following the manufacturer’s recommended protocol ...