Labshake search
Citations for New England Biolabs :
751 - 800 of 2189 citations for tert Butyl 10 oxo 4 9 diazaspiro 4.5 decane 4 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... 10 units of calf intestinal phosphatase (NEB), 5 units of antarctic phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U of T4 Polynucleotide Kinase (NEB) and 40 U Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 U of T7 endonuclease I (NEB) was added and incubated for 15 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 units of RNaseH (New England Biolabs) were added to the mix and allowed to digest at 37°C for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Scaffold strands (10 nM, M13mp18, Bayou Biolabs) were mixed with staple strands (100 nM ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with 10 µL RNaseH (NEB # M0297S) for 30 min at 37°C.
-
bioRxiv - Bioengineering 2023Quote: ... 10 µL HiFi 2X Master Mix (NEB), and water up to 20 µL ...
-
bioRxiv - Neuroscience 2023Quote: ... in 1:10 CutSmart Buffer (BioLabs #B6004S) at 37°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2023Quote: Restriction endonuclease BsaI (10 U/μL) (NEB), supplied with 10x NEB Buffer.
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM ribonucleoside-vanadyl complex (NEB, S1402S)) and incubated overnight at 37°C in a humidified chamber ...
-
bioRxiv - Genomics 2023Quote: ... 10 μl Large Klenow Fragment (NEB #M0210L) was added and the chromatin is incubated for 15 min at 37°C with shaking ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs), and centrifugated at 20,000 g for 2 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of enzyme (NEB, cat# R0543) was used in a 50 μl-reaction containing 5 μl of NEBuffer r3.1 (10X ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of 2% BSA (NEB B9000S), 2 μl of 20 U/mL SUPERaseIn ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10-beta cells (New England Biolabs) with 5 μl of the assembly mix according to the protocol provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 units T4 PNK enzyme (NEB) at 37 °C for 30 min.
-
bioRxiv - Genomics 2022Quote: ... 10 µL 25U/µL MboI (NEB, #R0147L) and 5 µL water were added to each tube and incubate at 37°C with rotation for 24 h ...
-
bioRxiv - Genomics 2023Quote: ... restriction enzyme (10 units of HpyCH4IV [NEB] for PCR7 and PCR31 ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 mM (NEB, cat. no. N0447S/L)
-
bioRxiv - Synthetic Biology 2024Quote: ... 10 units of T4 RNA ligase (NEB), 1X T4 RNA ligase reaction buffer (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL dNTP mix (NEB, 10 mM), 1 µL ENDOIV (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1 μL dNTP mix (NEB, 10 mM) and 2 µL 10x NEBuffer 3 (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL ENDOIV (NEB, 10 U/µL), 5 µL TAQ Ligase (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL ENDOIV (NEB, 10 U/µL) and 3 µL 10x NEBuffer 2 (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL ENDOIV (NEB, 10 U/µL) and 1 µL T4 PNK (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 U T4 RNA ligase 1 (NEB), 50 mM Tris-HCl pH=7.5 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 10 or 20 mM of NH4SO4) (NEB), 0.625 ng/µL of purified DNAP ...
-
bioRxiv - Neuroscience 2024Quote: ... 10 U T4 PNK (New England Biolabs) at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μl 10× blunting buffer (NEB; # B1201SVIAL), 5 μl dNTP 1 mM (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 10 units of XbaI (R0145, NEB). Another 500 ng of insert plasmid was digested in a separate reaction containing 10 units of SpeI-HF (R3133 ...
-
Anti-HIV-1 Effect of the Fluoroquinolone Enoxacin and Modulation of Pro-viral hsa-miR-132 ProcessingbioRxiv - Molecular Biology 2024Quote: ... and 10 units T4 polynucleotide kinase (NEB) in 1x PNK buffer in a total of 10 µl reaction volume at 37°C for 60 minutes ...
-
bioRxiv - Genomics 2024Quote: ... and 10 μL of CutSmart Buffer (NEB)) ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 units of Taq DNA polymerase (NEB), 5 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 10 µL of commercial TEV (Biolabs). After incubation overnight at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μl 10% NP-40 (NEB, B2704S), 5 μl H2O and 1 μl PNGase F (NEB ...
-
bioRxiv - Genomics 2024Quote: ... and 10 U Exonuclease V (RecBCD, NEB) were added to obtain a final volume of 13 µl ...
-
bioRxiv - Plant Biology 2024Quote: ... coli cloning strain 10-beta (NEB # C3019H). E ...
-
bioRxiv - Biophysics 2021Quote: ... in 500 μl T4 ligase buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP and 10 mM DTT, pH 7.5, NEB). Before adding the ligase ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 nM tritiated pSP1 was nicked either using 50 nM Cas12a RNP (WT protein with crRNA 24) at 25°C in Buffer RB for 10 s or using 10 units Nt.BspQI (New England Biolabs) per µg DNA ...
-
bioRxiv - Genomics 2023Quote: ... were mixed in 5 μL of 1x T4 DNA Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 10 mM Dithiothreitol; New England Biolabs) at a final concentration of 80 μM each and annealed by heating at 65 °C for 15 min ...
-
bioRxiv - Systems Biology 2023Quote: ... with 10 µL RT mix (5 µL 5x Maxima RT Buffer, 1.25 µL 10 mM/each dNTP [New England Biolabs #N0447S] ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were then incubated overnight at 37 °C in Hybridization Buffer (10% Formamide, 10% 20x SSC, 400 µg/ml E. coli tRNA (New England Biolabs), 5% dextran sulfate ...
-
bioRxiv - Biochemistry 2020Quote: ... and ddH2O to bring the volume to 10 μL were mixed with 10 μL 2X NEBuilder HiFi DNA Assembly Master mix (New England Biolabs) and incubated at 50 °C for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μL of 10 μM FISH probes in hybridization buffer (10% dextran sulfate [Sigma], 2mM vanadyl ribonucleoside complexes [#514025, NEB] ...
-
bioRxiv - Molecular Biology 2022Quote: ... MCC libraries were generated by digesting the chromatin in low Ca2+ MNase buffer (10 mM Tris-HCl pH7.5, 10 mM CaCl2) for 1 h at 37°C with MNase (NEB, M0247) added in varied concentrations (17-19 Kunitz U) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 15 μl of 10 mg/ml BSA and 10 μl of 400 U/μl of T4 DNA ligase (NEB, M0202)) and incubated 4h at 16ºC with mixing (800 rpm ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we added 10 ng of template plasmid to 100 μl of a PCR reaction mix that contains 10 μl of 10×ThermoPol buffer (M0267L, NEB), 2.5 μl of Taq DNA polymerase (M0267L ...