Labshake search
Citations for New England Biolabs :
701 - 750 of 2189 citations for tert Butyl 10 oxo 4 9 diazaspiro 4.5 decane 4 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... 10 mM Ribonucleoside Vanadyl Complex (NEB) and 100 U/ml Ribolock (Thermo Fisher Scientific)) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 10 uL of PEG 8000 (NEB), 1 mM of ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 units XhoI (New England Biolabs), primers for target and reference at 900 nM and probes at 250 nM ...
-
bioRxiv - Microbiology 2024Quote: ... 10 mM dNTPs (New England Biolabs), AMV reverse transcriptase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µL 10 mM dNTPs (NEB), 28 µL molecular biology grade water ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 10 U HincII (R0103S, NEB). The reactions were incubated at 37°C for 4 hours and heat-inactivated at 80°C for 20 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U ApoI-HF (R3566S, NEB) or 10 U HincII (R0103S ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 µL of Proteinase K (NEB) and 10 µL of DNAse I (ThermoFisher ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 µL 10 mM dNTPs (NEB), and 1 µL DNA Polymerase I ...
-
bioRxiv - Cell Biology 2024Quote: NEB 10-β bacterial strain (NEB) was used for molecular cloning.
-
bioRxiv - Developmental Biology 2024Quote: ... 10 mM dNTPs (NEB; Cat#N0447S), Taq DNA polymerase (NEB ...
-
bioRxiv - Genomics 2020Quote: ... 2.5 μl of 10 μM NEBNext i5 and 2.5 μl of 10 μM NEBNext i7 primers (NEB) in a final volume of 50 μl ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed and phosphorylated sgRNA (1:10) and T4 Ligase reaction buffer (1:10, #B0202S, New England Biolabs) with 10 mM 10x Adenosine 5’-Triphosphate (#P0756S ...
-
bioRxiv - Genetics 2020Quote: ... 10 mL of a 10% BSA solution was incubated with 2.5 μL of Proteinase K (NEB P8107S) for 30 minutes at room temperature (∼22°C) ...
-
bioRxiv - Genomics 2024Quote: ... 25 µL 10x CutSmart buffer and 10 µl 10 U/µL MseI restriction enzyme (New England Biolabs) were added ...
-
bioRxiv - Cell Biology 2024Quote: ... Library samples were enriched with 11 cycles of PCR amplification in 50uL of total reaction volume (10uL 5x KAPA buffer, 1.5uL 10 mM dNTPs, 0.5uL 10 mM NEB Universal PCR primer ...
-
bioRxiv - Cancer Biology 2023Quote: Pellets were resuspended in 99.25 µL micrococcal nuclease reaction buffer (1:10 micrococcal nuclease 10 x buffer (NEB), 1:100 10 mg/mL BSA in distilled water ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl 10 mM ATP (NEB, 0756), 1 µl 100 mM DTT (Cell Signaling Technology Europe ...
-
bioRxiv - Cell Biology 2020Quote: ... and 10% NP-40 (New England Biolabs) at 37°C for 60 mins.
-
bioRxiv - Genetics 2021Quote: ... 10 μL of Proteinase K (NEB, P8107S) was added to each sample and the sample was mixed well by pipetting ...
-
bioRxiv - Molecular Biology 2021Quote: ... Antarctic phosphatase from NEB (# M0289S-10 units), snake venom phosphodiesterase I (0.2 units ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of T4 DNA ligase (NEB), and 3 μl of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 10 units of Exonuclease V (NEB) in nuclease-free water ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μl 10mM ATP (New England Biolabs), 2 μl T4 ligase (New England Biolabs) ...
-
bioRxiv - Genetics 2020Quote: ... We added 10 µL rSAP (NEB #M0371L) and incubated at 37°C for 1 h to prevent plasmid re-ligation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 μL of 10 mM biotin (NEB) was then added to each sample on the plate and incubated for an additional five minutes to compete away purely biotin-dependent interactions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 U μL-1T4 Rnl2 (truncated) (NEB) and incubating for 3 hr at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 U of AMV reverse transcriptase (NEB) was added ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... coli DH 10-beta (New England Biolabs) was transformed with Gibson assembly product ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 ul of 10X G5 buffer (NEB), and 1ul of Endo H HF (NEB) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10-100 nM M13mp18 scaffold (Bayou Biolabs) was incubated with an excess of staple strands (IDT) ...
-
bioRxiv - Cell Biology 2022Quote: ... A 10 μl Gibson ligation reaction (NEB) was performed using 5 ng of the gel-purified inserts and 12.5 ng of the vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli strain 10-beta (New England Biolabs) or TOP10 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and treated with 10 units RppH (NEB) and 30 units T4 PNK (NEB) ...
-
bioRxiv - Genetics 2022Quote: ... 10 U of T7EI ((M0302S, NEB, USA) was added and incubated at 37 ℃ for 30 min ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs). Lysates were centrifugated at 14,000 g for 10 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl 50% PEG 8000 (NEB, M0242), 1 μl 40 U μl-1 RNase Inhibitor (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 10 units of BstUI (Nex England Biolabs) were added to each reaction and incubation was conducted at 37°C for 3 h ...
-
bioRxiv - Genomics 2020Quote: ... 10 U T4-βGT (NEB, Ipswich, MA). The reaction was initiated by adding Fe (II ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µl 5x GC Buffer (NEB, USA), 1 µl dNTP mix (10 mM each ...
-
bioRxiv - Genomics 2021Quote: ... and 10 U T4 RNA Ligase1 (NEB). Reaction mixtures were incubated at 37°C for 2.5 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs), and centrifugated at 20,000 g for 2 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of enzyme (NEB, cat# R0543) was used in a 50 μl-reaction containing 5 μl of NEBuffer r3.1 (10X ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of 2% BSA (NEB B9000S), 2 μl of 20 U/mL SUPERaseIn ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10-beta cells (New England Biolabs) with 5 μl of the assembly mix according to the protocol provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 units T4 PNK enzyme (NEB) at 37 °C for 30 min.
-
bioRxiv - Genomics 2022Quote: ... 10 µL 25U/µL MboI (NEB, #R0147L) and 5 µL water were added to each tube and incubate at 37°C with rotation for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with 10 µL RNaseH (NEB # M0297S) for 30 min at 37°C.
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U of T4 Polynucleotide Kinase (NEB) and 40 U Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...