Labshake search
Citations for New England Biolabs :
751 - 800 of 2865 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... and resolved on a 4–20% SDS-polyacrylamide gel (NEB). The presence of MeCP2 was assayed by western blotting using anti-MeCP2 monoclonal antibody M6818 (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µl of thermolabile proteinase K (New England Biolabs, P811S) added to Mitochondria-bound beads resuspended in 30 µl of KPBS ...
-
bioRxiv - Biophysics 2023Quote: ... “no SDS” loading dye (New England Biolabs, UK; 4 µL) was added to each sample (15 µL ...
-
bioRxiv - Systems Biology 2023Quote: ... and SpeI-HF (New England Biolabs, Ipswitch, MA;, and 4) the barcode fragment digested with BstEII-HF (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 4°C) and filled in using T4 DNA polymerase (NEB) using manufacturers’ instructions at 12°C for 20 min75 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... We treated the crRNA with 4 U DNase I (NEB) to remove any remaining DNA templates for 15 minutes ...
-
Analysis of natural structures and chemical mapping data reveals local stability compensation in RNAbioRxiv - Biophysics 2024Quote: ... 4 μL of T7 RNA polymerase (New England Biolabs #M0251S), and 33 μL RNase-Free water ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 μL of 10X T4 DNA ligase buffer (NEB). The thermocycling protocol was 30 cycles of 5 min digestion at 37°C and 5 min ligation at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 ng of DNA was digested with 6 to 12 U of the restriction enzyme PvuII (NEB) overnight at 37°C.
-
bioRxiv - Genomics 2020Quote: ... DNA libraries were amplified by PCR for 6-10 cycles with Phusion HF DNA Polymearse (NEB, M0530) using Illumina TruSeq indexing primers for multiplexing ...
-
bioRxiv - Cell Biology 2020Quote: ... Images were collected every 10 mins for up to 6 days and the timing of events (NEB, the start of cytokinetic furrow ingression and the appearance of 2 distinct cells ...
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions were performed with 6 μl of PURExpress ΔRF123 in vitro protein synthesis system (New England Biolabs) in the presence of 1x RF3 ...
-
bioRxiv - Biophysics 2023Quote: ... and the DNA of the SL5-6 domains was then digested using BsaI (New England Biolabs #R0535) followed by Mung Bean Nuclease (New England Biolabs #M0250) ...
-
bioRxiv - Systems Biology 2023Quote: ... N6-(6-Azido)hexyl-3’-dATP were added to ssDNA oligos (Biolegio) using terminal transferase (TdT, NEB) at 25:1 molar ratio for 2h at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... The resulting mixtures were loaded on a 6% native polyacrylamide gel with SDS-free loading dye (NEB). The gel was made with TAE-Mg buffer (0.4 M Tris ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cole) containing an N-terminal 6×His-tag using NEBuilder HiFi DNA Assembly Master Mix (NEB E2621L). The LSD1 constructs were expressed in BL21-CodonPlus (DE3)-RIPL competent E ...
-
bioRxiv - Neuroscience 2024Quote: ... tube 2: 20 µL VLP suspension + 6 µL water + 1 µL Proteinase K (200 µg/mL, NEB), and tube 3 ...
-
bioRxiv - Biophysics 2024Quote: ... then mixed with 0.2 volumes of 6× Agarose Gel Loading Dye (Purple, no SDS, New England Biolabs) and analyzed on a 1% agarose gel containing SYBR Safe ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Immunology 2022Quote: ... To generate a truncated version of Siglec-5 (pME- tSiglec-5) the ITIM and ITSM were excised from the pME-Siglec 5 plasmid with the restriction enzymes BbsI/MfeI (NEB, Ipswich, MA) and blunt ends were generated with DNA Polymerase I ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using 5 units of MseI enzyme per 1 μg of DNA and 5 μl of 1X SmartCut™ Buffer (New England Biolabs®). This was followed by the incubation for 45 min at 37°C and inactivation for 20 min at 65° C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl of the gRNA mixture was mixed with Cas9-NLS protein (final concentration of 5 μM. New England Biolabs, Ipswich, USA), 2M KCl (final concentration of 300mM) ...
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Biophysics 2024Quote: ... First the 5’ triphosphate of RNA was converted into a 5’ monophosphate by incubating 100 µg RNA with 100 units of RNA 5’ Pyrophosphohydrolase (NEB, Ipswich MA) at 37°C for 1 hour within a 100 µl reaction volume ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Genetics 2023Quote: ... 10 µg of the K3L variant library was digested with 5 µL of BstEII-HF and 5 µL SacI-HF (NEB Cat#R3156S) in a 50 µL reaction to generate a linear insert fragment of approximately 1130bp ...
-
bioRxiv - Microbiology 2024Quote: ... The variable region V3+V4 of the 16S rRNA gene was amplified using a broad-range primer pair (338F: 5’-ACTCCTACGGGAGGCAGCA-3′, 806R:5′-GGACTACHVGGGTWTCTAAT-3′) using the Phusionâ High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program was as follows ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was generated from Venus BBa_J176006 with primers 5’-tctgcacctgaggccaccatggtgagcaagggcgagg and 5’-ggtcacgaattccagcaggaccatgtgatcg via high fidelity PCR followed by spin-column purification (NEB #E0555, Sigma #NA1020). The YFP fragment and mutated pSBtet-GP plasmid were double-digested with Eco81I/ EcoRI (Thermo #FD0374 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The library was amplified in triplicate PCR reactions using oligonucleotides corresponding to the Illumina sequence adaptors (5’-AATGATACGGCGACCACCGAGATCTACAC-3’ and 5’-CAAGCAGAAGACGGCATACGAGAT-3’) and Phusion DNA polymerase (New England Biolabs, cat. M0531) for 11 cycles ...
-
bioRxiv - Biophysics 2024Quote: ... The PDZ and Protease domain of HtrA1 were amplified using primers 5’-ATCACCAAGAAGAAGTATATTG-3’ and 5’-GGATCCTTTTTCGAACTGC-3’ as well as 5’-TAGCTCGAGCACCACCAC-3’ and 5’-TTTGGCCTGTCGGTCATG-3’with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs, MA). The mutation of S328A of HtrA1 and its Protease domain were created using primers 5’-CTATGGAAACgcgGGAGGCCCGT-3’ and 5’-TTGATGATGGCGTCGGTCTG-3’ with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Biophysics 2024Quote: ... The mutation of S328A of HtrA1 and its Protease domain were created using primers 5’-CTATGGAAACgcgGGAGGCCCGT-3’ and 5’-TTGATGATGGCGTCGGTCTG-3’ with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs, MA). The PCR protocol was as followed ...
-
bioRxiv - Biochemistry 2020Quote: ... Amino acid substitutions were made using the Q5 Site-directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA) to generate pNG309 and pNG307 for expression of xoxF1 D320A and exaF D319S ...
-
bioRxiv - Molecular Biology 2022Quote: ... Removal of sialic acids was performed using the α2-3,6,8 neuraminidase (New England Biolabs, 50 U/μg protein). Removal of fucose was performed using α1-2,4,5,6 fucosidase O (New England Biolabs ...
-
bioRxiv - Genetics 2022Quote: ... or FLAG (amino acid sequence: DYKDDDDK) with a kit (Gibson assembly kit from New England Biolabs, catalogue # E5510S). The different combinations were cloned into pJFRC7-20XUAS-IVS-mCD8::GFP (Addgene # 26220 ...
-
bioRxiv - Biophysics 2021Quote: ... of 0.1M sodium hydroxide: 0.02M 2-(n-morpholino) ethanesulfonic acid (MES) or 1X NEB DNase I reaction buffer (NEB B0303S ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid substitutions in pCDNA3-HA-CoV2-Nsp1 vector were introduced using Phusion PCR mutagenesis (New England Biolabs) to generate pCDNA-HA-CoV2-Nsp1(R99A ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 nM okadaic acid (Enzo LifeSciences, ALX-350-011-M001) 50 U micrococcal nuclease (New England Biolabs, M0247S)) ...
-
bioRxiv - Genomics 2021Quote: ... 5’-deadenylase (Cat. No. M0331S; NEB; use 0.5 uL), PEG 8000 (final concentration = 10% (w/v)) ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide was 5’-labeled using PNK enzyme (NEB). The ITS2 probe was previously reported (Donati et al. ...
-
bioRxiv - Genomics 2021Quote: ... 5 U of Klenow Fragment (New England Biolabs, M0210) were added and incubated at 25°C for 20 minutes ...
-
bioRxiv - Genomics 2022Quote: ... 5 units (50 Gel Units) of Micrococcal Nuclease (NEB) were added to one tube and 20 units (200 Gel Units ...
-
bioRxiv - Molecular Biology 2020Quote: ... Un-reacted linkers were digested with 5’ deadenylase (NEB) and RecJ exonuclease (epicentre ...
-
bioRxiv - Genomics 2020Quote: ... 5′ end phosphorylation using T4 polynucleotide kinase (NEB, M0201L), (4 ...