Labshake search
Citations for New England Biolabs :
551 - 600 of 2865 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: For a typical blunting reaction 5-50 ng of cfDNA are mixed with 5 μl of CutSmart 10x (NEB), 5 μl of dNTPs 1mM each ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 µL of the CspCI digest was mixed with 5 µL of NEBuilder HiFi DNA Assembly Master Mix (NEB), incubated at 50 °C for 15 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and 5 mM MgCl2) followed by a phosphorylation step of the 5’-terminal ends by the T4 PNK (NEB). This dsDNA duplex was ligated into the large plasmid digested with KpnI (NEB ...
-
bioRxiv - Genomics 2024Quote: M13seq primer (5’-GACGTTGTAAAACGACGGC-3’) was labeled with 32P at 5’-end by T4 polynucleotide kinase (New England Biolabs). Primer/template (p/t ...
-
bioRxiv - Bioengineering 2024Quote: ... following the manufacturer’s instructions and 3′-O-Me-m7G(5′)ppp(5′)G RNA cap (New England Biolabs, USA) was used as the cap structure analog ...
-
bioRxiv - Bioengineering 2024Quote: ... 5’-AGCTACCGACAACAACGTGT-3’ and Cap9_ Kpn/Age_Rev: 5’-AGAAGGGTGAAAGTTGCCGT-3’ and Phusion High-Fidelity PCR kit (New England Biolabs). The amplicon was gel purified digested with KpnI ...
-
bioRxiv - Plant Biology 2021Quote: ... Residual primers and nucleic acids were removed from PCR reactions with Exonuclease I (New England BioLabs) and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR product was purified using Monarch® Nucleic Acid Purification Kit (New England Biolabs Inc.).
-
bioRxiv - Molecular Biology 2021Quote: ... Customized PURExpress reconstituted systems lacking all amino acids and release factors (Δaa, ΔRF123) (New England Biolabs) (Fig ...
-
bioRxiv - Microbiology 2022Quote: ... aliquots of 200 ng nucleic acid were treated with 2 U DNase I (New England Biolabs), 10 U S1 nuclease (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic deoxyribonucleic acid (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England BioLabs, T3010S) following procedures for Tissue gDNA isolation ...
-
bioRxiv - Genomics 2023Quote: ... 10 μL of extracted nucleic acid was treated with DNase I (New England Biolabs, Ipswich, MA), followed by a clean up step using a ratio of 1.8:1 beads to sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... To digest sialic acid: 2 μL of α2-3,6,8 Neuraminidase (50U/mL, New England Biolabs, NEB) with GlycoBuffer 1 (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... To digest sialic acid: 2 μL of α2-3,6,8 Neuraminidase (50U/mL, New England Biolabs, NEB) with GlycoBuffer 1 (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... Single amino acid substitutions were introduced using NEB’s site-directed mutagenesis kit (New England Biolabs, E0552S). Primers used for cloning and site-directed mutagenesis are listed in Table S2 ...
-
bioRxiv - Genetics 2020Quote: ... and 4 μl of DNA polymerase I Klenow (NEB), and incubating at 37 °C for 1 hour with rotation ...
-
bioRxiv - Microbiology 2021Quote: ... 9 Neuraminidase A (P0722, NEB, 4 units/µg protein). 10 µg glycoprotein ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 μL T4 polynucleotide kinase (New England BioLabs) in a 100 μL reaction for 2 hours and purified using P-30 spin columns (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/µl Taq DNA ligase (M0208S, NEB)).
-
bioRxiv - Molecular Biology 2022Quote: ... including 2.5-4 min fragmentation at 94⁰C (NEB).
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... were mixed with 4 uL T4 buffer (NEB B0202S), 4 uL BbsI-HF (NEB R3539L ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of 5x Phusion HF Buffer (NEB #B0518), and 1.6 µL of 2.5 mM dNTPs (NEB #N0447) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of 5x Phusion HF Buffer (NEB #B0518S), and 0.4 µL of 10 mM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... transcripts were treated with 4 U DNase I (NEB) for 30 min at 37°C and subsequently separated on urea-polyacrylamide (PAA ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4 μL of α2-3,6,8,9 Neuraminidase A (NEB) in 1x NEB Glyco Buffer #1 (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... micrococcal nuclease (MNase; 4×105 units; New England Biolabs) or RNase A (2 µg ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 μL of t7 polymerase (New England Biolabs #M0251S), 33 μL RNase-Free water ...
-
bioRxiv - Biochemistry 2024Quote: ... and 4 units of Proteinase K (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of murine RNase inhibitor (New England Biolabs), and 40 μg (HEK293T and U2OS cells ...
-
bioRxiv - Genomics 2022Quote: ... 4 U of T7 DNA polymerase (New England Biolabs) were used to perform second-strand synthesis and DNA was purified using CleanPCR beads ...
-
bioRxiv - Microbiology 2022Quote: ... 4 μL of 10X RNase H buffer (NEB B0297S) and incubating for 30 minutes at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... and 4 μl of Klenow DNA polymerase (NEB M0210L) to the mixture ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 4 µL of α2-3,6,8,9 Neuraminidase A (NEB,) in 1x NEB Glyco Buffer #1 (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... incubated with 4 units of Dam enzyme (NEB, M0222L). We use Damonly control samples to normalize for DNA accessibility and amplification biases as described (Vogel et al ...
-
bioRxiv - Genomics 2024Quote: ... incubated with 4 units of Dam enzyme (NEB, M0222L). We use Dam-only control samples to normalize for DNA accessibility and amplification biases as described (77) ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were end-repaired and T-tailed with Klenow fragment lacking 5’ → 3’ and 3’ → 5’ exonuclease activity (NEB). In-house adapters containing 8-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Cell Biology 2021Quote: ... and DNA fragments were amplified by PCR with NEXTFlex primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) and further purified with AMPure XP beads to eliminate unligated primers and adapters ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of the boiled colony was used for PCR with primer pair (JGI_27F: 5’-AGAGTTTGATCCTGGCTCAG-3’and JGI_1391R: 5’-GACGGGCRGTGWGTRCA-3’) with NEB Q5 Polymerase (New England Biolabs, Ipswitch, MA). The PCR amplicon was confirmed by agarose gel electrophoresis and the sequence was determined using conventional Sanger Sequencing (Genewiz LLC ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped by incubating at 65°C for 5 min followed by addition of 5 mM MgCl2 and 0.5 units of Shrimp Alkaline Phosphatase (rSAP, NEB M0371S). The phosphatase reaction was incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... RJ-167-mer and RJ-5’Tail-167mer were radiolabeled with 32P at the 5′-end using T4 Polynucleotide Kinase (NEB). To generate the 3′ Tail and dsDNA DNA substrates ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... forward and reverse primer for GFP (forward 5’TCGACAGTCAGCCGCATCT3’ and reverse primer 5’CCGTTGACTCCGACCTTCA3’) respectively using 1μl taq polymerase (NEB, USA). The PCR amplification was performed as per the following cycle ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...
-
bioRxiv - Genetics 2022Quote: ... was assessed via PCR amplification using OneTaq 2x Master Mix (forward primer DLO1142 5’-ACCCATTTCCCATTCAATCA-3’ reverse primer DLO1143 5’-TTGTAATCTGCCCCAAAAGG-3’) and subsequent HpaII restriction digest (New England Biolabs). DLW135 carried a wild type allele of pho-9 ...
-
bioRxiv - Systems Biology 2020Quote: ... and at least 1 μg but no more than 5 μg DNA was put into an end-resection reaction (5 U T4 DNA Polymerase, NEB) to remove biotin from unligated ends ...