Labshake search
Citations for New England Biolabs :
7651 - 7700 of 8151 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... The SETD3 V266D mutant was introduced into EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) by Gibson Assembly (New England Biolabs). The SETD3 V266D construct was then used as a template to sequentially incorporate Q257A and Y288P mutations by Phusion site-directed mutagenesis using the following primer pairs ...
-
bioRxiv - Biophysics 2022Quote: ... This SETD3 mutant was introduced into EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) by Gibson Assembly (New England Biolabs).
-
bioRxiv - Biophysics 2022Quote: ... The SETD3 G361R mutant was introduced into EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) by Gibson Assembly (New England Biolabs). The SETD3 G361R construct was then used as a template to incorporate F409A or F409A and N413A mutations by Phusion site-directed mutagenesis using the following primer pairs ...
-
bioRxiv - Cancer Biology 2022Quote: ... A minimum of 1 μg (20 ng/μl) of high-quality total RNA (extracted using Monarch Total RNA Miniprep Kit, NEB) was supplied for sequencing ...
-
bioRxiv - Cell Biology 2022Quote: INS-1 832/3 EV and g1-2 cells transiently expressing the SNAP-GLP-1R were labelled at 37°C with 1 μM of SNAP-Surface 649 fluorescent substrate (S9159S, New England Biolabs) in full media prior to treatment with 100 nM exendin-4 or vehicle for 3 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNAs were diluted 1:20 and then qPCR was carried out in triplicate using the Luna Universal qPCR Master Mix (New England Biolabs). 3 primer sets targeted different exon-exon junctions in the lmo7a coding region and primers targeting rps13a as the control housekeeping gene were used for normalization ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR product sizes were analyzed in comparison to migration of markers in 100 bp and 1 kb ladders (New England Biolabs).
-
bioRxiv - Cancer Biology 2020Quote: ... Coverslips were treated with RNase A (Fermentas) for 1 hour at 37°C and where indicated with RNase H (NEB) for 24 hours at 37°C prior to blocking ...
-
bioRxiv - Genomics 2020Quote: ... Methylation reactions were performed in a 100 uL reaction with Methylation Reaction buffer (1X CutSmart Buffer,1 mM S-adenosyl-methionine (SAM, New England Biolabs)) and incubated with 2.5 uL EcoGII at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was pelleted at 18,000xg for 10 minutes and supernatant was removed before the pellet was resuspended in 50 μL trypsin reaction buffer and 1 μg trypsin (New England Biolabs) added and the suspension incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg of purified IE1 DNA was then digested with ClaI and SpeI restriction enzymes (New England Biolabs, Ipswich, MA). Digested DNA was cleaned using the DNA clean and concentrator kit (Zymo Research ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μg pAd5-Blue was digested with ClaI and XbaI and dephosphorylated using Quick CIP (New England Biolabs, Ipswich, MA). Enzymes were heat inactivated by heating to 80 °C for 5 minutes and DNA precipitated using 100% ethanol ...
-
bioRxiv - Molecular Biology 2022Quote: ... MCC libraries were generated by digesting the chromatin in low Ca2+ MNase buffer (10 mM Tris-HCl pH7.5, 10 mM CaCl2) for 1 h at 37°C with MNase (NEB, M0247) added in varied concentrations (17-19 Kunitz U) ...
-
bioRxiv - Developmental Biology 2022Quote: Samples included 1) cDNA generated from >200nt RNA extracted previously from the 12h embryo sample (LunaScript RT Mastermix Kit, New England Biolabs). 2 ...
-
bioRxiv - Microbiology 2022Quote: ... Then barcodes from the Native Barcoding Expansion 1-12 & 13-24 from Oxford Nanopore Technologies (ONT) were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA was purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2022Quote: ... Designed fragments were PCR-amplified from purified phage A006 or synthetic DNA to yield a total of six DNA fragments per phage genome followed by Gibson assembly at 50°C for 1 h in a total reaction volume of 20 µl (NEBuilder HiFi DNA Assembly Cloning Kit, New England Biolabs). Assembly reactions were carried out with purified DNA fragments to yield synthetic genomes ...
-
bioRxiv - Cell Biology 2022Quote: ... an 887bp portion of mtDNA containing nd-1 was amplified by PCR and TA-cloned into pMiniT2.0 using the NEB PCR cloning kit (NEB E1202S). Purified plasmid was linearized with BamHI-HF (NEB 3136) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The resulting PCR fragment and the peGFP-N1-1 vector were sequentially digested with SalI and SacII prior to ligation with Quick ligase (New England Biolabs) to make a pcachd1-eGFP-N1-1 plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... Single stranded gaps between hybridized oligonucleotides were then filled in by combining 5 µL of the hybridized oligonucleotides from the previous annealing step with 1 unit Q5 High Fidelity DNA polymerase (New England Biolabs), 1X Q5 Reaction Buffer (New England Biolabs) ...
-
bioRxiv - Genomics 2019Quote: The degenerate barcoded plasmid was used as template for PCR using primers containing gene-specific targeting homology arms (1× NEB Q5 Master Mix #M0494S ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added 150 – 1000 ng of DNA to 1 μl of prepared MBD2-Fc/protein A beads (New England Biolabs), then washed and eluted the DNA as described by Chiou and Bergey (2018) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mixture was denatured and annealed in a PCR machine and subsequently digested with 1 µL of T7 endonuclease (New England Biolabs) following the manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 25–50 ng of template DNA was added to Polymerase Chain Reactions (PCR) containing 1× Standard Taq Buffer (New England Biolabs), 2.5 mm MgCl (New England Biolabs) ...
-
bioRxiv - Biophysics 2019Quote: ... Site directed mutagenesis of the HEV510-696 was performed using primers detailed in Table 1 and the Q5 Site-directed Mutagenesis Kit (NEB).
-
bioRxiv - Genetics 2019Quote: ... The donor sequence was generated by subcloning 596 bp upstream of the hrpk-1 stop codon and 600 bp downstream of hrpk-1 stop codon into the pDD282 vector [45] using Hi Fi assembly kit (NEB). The hrpk-1 stop codon was eliminated from the donor sequence to allow in frame GFP tag addition ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Alleles were PCR amplified using Takara DNA polymerase (Thermo) and cloned into pICH40121 as ∼1 kb modules with SmaI/T4 ligase (New England Biolabs). The modules in pICH40121 were assembled into binary vector pICH86988 under control of the constitutive 35S cauliflower mosaic virus promoter and in C-terminal fusion with 6xHA or 3xFLAG epitope ...
-
bioRxiv - Synthetic Biology 2020Quote: 10 ng of DNA oligo out of the master pool was attached to 1 μL of Streptavidin Magnetic Beads (NEB). The iDR reaction mixtures contained 1 μL of the DNA template attached to the beads (10 ng/μL) ...
-
bioRxiv - Genomics 2019Quote: ... The assembly reaction of 1:5 vector:insert ratio was carried out for 1 hour at 50C using NEBuilder HIFI DNA assembly kit (New England Biolabs, NEB). Assembly products were electroporated into NEB Turbo Competent E.Coli (NEB ...
-
bioRxiv - Genomics 2019Quote: ... The assembly reaction of 1:5 vector:insert ratio was carried out for 1 hour at 50C using NEBuilder HIFI DNA assembly kit (New England Biolabs, NEB). Assembly products were electroporated into NEB Turbo Competent E.Coli (NEB ...
-
bioRxiv - Biophysics 2019Quote: ... and 15-25 μM of BG-oligonuculeotides were labeled with ∼ 1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg of the gapped plasmid was annealed to the appropriate 39 nt oligonucleotides (1:100 molar ratio, Supplementary Table S1) and ligated overnight with T4 DNA Ligase (NEB). Restoration of a KpnI restriction site present in the gapped region confirmed incorporation of mismatch oligonucleotides ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (NEB) and amplified 7 cycles by PCR in the presence of SYBR Green in order to obtain an optimal yield ...
-
bioRxiv - Genomics 2020Quote: ... The treated RNA samples were incubated with 100 μM RNA rP5_RND oligo (final 10 μM, Table S3) 2h at 25°C with 10 Units of T4 RNA ligase 1 (NEB). Please note that we used an RNA oligo ...
-
bioRxiv - Biochemistry 2020Quote: ... SMN-Gemin2 complex was produced by co-expression of SMN (residues 1-294) and Gemin2 (12-280) fused to a C-terminal Mxe intein (NEB) containing a hexahistidine tag ...
-
bioRxiv - Developmental Biology 2020Quote: ... 300ng of undigested gDNA and from each restriction reaction were loaded in a 1% agarose gel with molecular weight marker (N3232, NEB). 160V current was applied for 30min in a Midigel tank (370000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... the concentration of eluted MBP-mintbody was adjusted to 1 mg/ml and digested with 30 μg/ml Factor Xa (New England Biolabs) for 24 h ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA (1 μg) or TRAP-isolated RNA (200 ng) was subjected to the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB) to isolate mRNA and proceeded directly to double stranded cDNA synthesis ...
-
bioRxiv - Molecular Biology 2019Quote: ... Inserts were then incubated for 1 hour at 37°C in the presence or absence of SssI methylase (New England BioLabs). The efficiency of the methylation reaction was verified by resistance to cleavage by the methylation-sensitive restriction enzyme HpaII (New England BioLabs) ...
-
bioRxiv - Plant Biology 2021Quote: ... Selected SNPs were converted to restriction enzyme-based Cleaved Amplified Polymorphic Sequence (CAPS) markers (Supplementary Table 1) using Neb cutter v2.0 (New England Biolabs Inc). Restriction digestion was performed according to the manufacturer’s protocols ...
-
bioRxiv - Biophysics 2021Quote: ... and 15–25 μM BG-oligonuculeotides were labeled with ∼1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cell pellets were washed 1× with PBS and collected in 1X DNA/RNA protection reagent (Monarch Total RNA Miniprep Kit, NEB). Cells were lysed and total RNA was isolated following the mammalian cell protocol inlcuding on-column DNase I treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... Purified DNA from the ChiP procedure (25 μL) was digested with 1 μL of I-SceI endonuclease (#R0694S, New England Biolabs) for 1 h and heat inactivated ...
-
bioRxiv - Microbiology 2020Quote: ... but our procedure differed slightly as (1) we ‘padded’ a given sample with linear double-stranded lambda DNA (New England Biolabs) if the sample did not meet the manufacturer DNA input mass recommendations (1000 ng ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μL of eluted RNA was mixed with 1 μL of 200 ng/μL random nonamer primer (New England Biolabs), incubated at 65°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... the annealed primers and purified digested vector were ligated at a 15:1 insert to backbone molar ratio using Instant Sticky-end Ligase Master Mix (M0370S, NEB). A non-targeting control (miR-NTC ...
-
bioRxiv - Biophysics 2019Quote: ... gels were gently removed from the chamber and digested overnight at 37 °C in 8 units mL−1 Proteinase K (NEB) diluted in digestion buffer (1× TAE buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... Messenger RNA (mRNA) was enriched from 1 μg of total RNA by Poly(A) mRNA Magnetic Isolation Module (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... plasmids were linearized using two REs (Figure 1) and PCR-amplified parts were assembled into the linear vectors using the NEBuilder HiFi DNA Assembly Master Mix (NEB) for 1h at 50°C ...