Labshake search
Citations for New England Biolabs :
7551 - 7600 of 8151 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM dithiothreitol (catalog no ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...
-
bioRxiv - Genomics 2023Quote: ... Following this, 2μL Exonuclease 1 (20U/μL, Enzymatics X8010L) and 1μL Shrimp Alkaline Phosphatase (rSAP) (1U/μL, NEB M0371L) was added to each reaction followed by vortexing and incubation in a thermocycler at 37°C for 30min followed by 4°C forever.
-
bioRxiv - Molecular Biology 2023Quote: ... in buffer 3 (100 mM NaCl, 50 mM Tris-HCl, pH 7.9, 10 mM MgCl2, and 1 mM DTT, New England Biolabs) or in 50 mM NaCl ...
-
bioRxiv - Genetics 2023Quote: ... 8.5 μl of phosphorylated product was combined with 1 μl of 10x T4 ligase buffer and 0.5 μl of T4 DNA ligase (NEB), incubated at 16℃ overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... the culture was diluted to 0.1 OD before adding 1 μM silicon-rhodamine benzylguanine derivative SNAP-SiR647 (SNAP-Cell 647-SiR, New England Biolabs). Culture tubes were wrapped in aluminum foil and incubated on a rotator for 15 hours ...
-
bioRxiv - Microbiology 2023Quote: A 10 µL reaction containing 200 ng of pTrc200HA plasmid DNA and 1× CutSmart Buffer (New England BioLabs, USA) with partially purified V2c or its variants normalized by the major V2c protein band was incubated at 37°C for 1 hour ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM DTT (catalog no ...
-
bioRxiv - Molecular Biology 2023Quote: ... that can base pair to the 3’ nucleotide of the cDNA products as described.75,76 The reaction was stopped by adding proteinase K (1 unit; New England Biolabs) and 25 mM EDTA followed by clean-up with a Monarch PCR & DNA Cleanup Kit (New England Biolabs) ...
-
bioRxiv - Biochemistry 2024Quote: ... and clarified by centrifugation at 16,100 x g for 1hr and incubated with ∼1 mL of pre-equilibrated compact amylose affinity resin beads (NEB). The resin was washed three times with buffer H ...
-
bioRxiv - Microbiology 2024Quote: ... a 30 uL aliquot of lysate was transferred to a clean 1.5 mL microcentrifuge tube and incubated with 1 uL Endo-H (NEB) for 45 min in a 37C bead bath ...
-
bioRxiv - Microbiology 2024Quote: ... Flanking regions of 1 kb on either side of the target gene were PCR amplified using Q5 polymerase (NEB) and cloned into pLGB13 using the NEBuilder HiFi cloning kit (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... A 1:200 dilution of the double-stranded gRNA was ligated into BsmBI-digested plasmids using T4 ligase (NEB). One µL of the ligated vector was then transformed into chemically competent XL Gold E ...
-
bioRxiv - Molecular Biology 2024Quote: 1 µl of DMS-modified RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.81 nmol LbCas12U protein and 0.45 nmol of each of three crRNAs were assembled in 1 x Nuclease Reaction Buffer (NEB). Protein and crRNAs were mixed and incubated for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... were split into two equal samples and incubated at 50°C for 25 minutes with exonuclease 1 (NEB, M0293) to remove unintegrated barcoded transposon adapters ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg mL−1 BSA at pH 7.9; New England Biolabs). The reactions were incubated at 37 °C for 20-45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All reactions were then digested with 1 µl ExoI and purified using the Monarch DNA Gel Extraction Kit (NEB), eluting in 10 µl of elution buffer (10 mM Tris•Cl pH 7.4) ...
-
bioRxiv - Plant Biology 2020Quote: ... and cDNA was synthesized from 1 µg of total RNA using ProtoScriptR II Reverse Transcriptase (New England BioLabs, MA, USA) in 20 µl reaction with oligo (dT ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and +1 sites of the promoters controlling transcription of both RNAs were used to amplify the standard pUC19 plasmid (NEB). After PCR amplification samples were digested with DpnI (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Ni-NTA resin elute was immediately diluted with PBS containing 1 mM EDTA (PBS-E) and incubated with amylose resin (New England Biolabs) for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was then diluted 1:10 with nuclease free water prior to adding 1 µL to a PCR reaction containing 500 uM forward and reverse primer and 1X Q5 Master Mix (NEB). Reactions were cycled 35 times with annealing temperatures calculated by NEB Tm calculator prior to loading on 2% agarose gels ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 μg/ml phenylmethylsulfonyl fluoride and protease inhibitor) and resuspended again in 1 ml MNase digestion buffer with 1,250 Units MNase (NEB Biolabs). Chromatin-MNase mix was incubated at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Endogenous mRNA was removed by treating the pooled fractions (200 μL) with 2.4 μL CaCl2 (40 mM stock) and 1 μL micrococcal nuclease (New England BioLabs M0247S) at room temperature for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA coding region corresponding to RDGBPITPd-FFAT (amino acids 1-472) was subcloned into pUAST-attB by using the restriction enzymes NotI and XbaI (NEB). Similarly ...
-
bioRxiv - Genetics 2021Quote: ... ChIP-Seq libraries were prepared from 1-40 ng of DNA using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Adaptors were diluted 10-fold prior to ligation ...
-
bioRxiv - Developmental Biology 2021Quote: ... Following the adaptor ligation each sample was mixed with 20 μl of a 2x DpnII Digestion Buffer and 10 units (1 μl) of DpnII restriction enzyme (New England Biolabs) mastermix and were incubated for 3 hours at 37 °C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The resulting library was pooled into 12 separate 60 amino acid long sub-libraries (amino acids 1-60, 61-120 etc.) and combined via Gibson Assembly (NEB) with a linearized p414ADHΔter Hsp90 destination vector ...
-
bioRxiv - Genetics 2021Quote: ... 1 μg of RNA was reverse transcribed in cDNA using random hexamers and M-MuLV reverse transcriptase (New England Biolabs). Quantitative PCRs were assembled with Absolute QPCR ROX Mix (Thermo Scientific ...
-
bioRxiv - Genomics 2021Quote: ... All the other gDNA from the bacteria presented in Table 1 were isolated using the Monarch genomic DNA purification kit (T3010S, New England Biolabs). Xp12 phage genomic DNA was obtained from Peter Weigele and Yian-Jiun Lee at New England Biolabs.
-
bioRxiv - Microbiology 2019Quote: ... The purified DNA was used as template to perform the 2nd step PCR using NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (New England Biolabs), followed by Bioanalyzer analysis and gel purification ...
-
bioRxiv - Microbiology 2019Quote: In vitro transcribed 3X-FLAG tagged manY transcripts – wild-type or Δenh (1 pmol) were translated in vitro using the PURExpress translation kit (NEB). Translation reactions were stopped by adding Laemmli sample buffer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... These gBlocks were assembled into an expression vector on the pETDuet-1 plasmid backbone with the help of the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). First ...
-
bioRxiv - Developmental Biology 2021Quote: ... A small multiple cloning site was added before the start codon of exon 1 by site directed mutagenesis (Q5 SDM Kit, New England Biolabs) using the primers rab11a-MCS-SDM-forward 5’-tactagttccATGGGGACACGAGACGAC-3’ and rab11a-MCS-SDM-reverse 5’-agaccggtaggCTCGATCAAAACAAAAGCGC-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... Annealed oligos were diluted to 1:200 and were used as inserts for ligating to digested lentiCRISPR v2 (50 ng) by T4 DNA Ligase (NEB) in 10X T4 DNA Ligase buffer (NEB) ...
-
bioRxiv - Physiology 2020Quote: We prepared RNAseq libraries from 1 μg of total RNA with the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB) according to the manufacturer protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Supplementary Data 1) P1 adapters (200 nM) containing unique 12 bp barcodes were ligated by incubation with T4 ligase (NEB) at room temperature for 30 min and the reaction was terminated by 20 min at 65°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 40 μl 50% PEG 8000 for 1 hour at room temperature then incubated overnight at 25°C in 100 μl 1x T4 RNA ligase buffer (NEB) containing 40 μl 50% PEG 8000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PEARL extracts from cultured cells were treated with either DNase I (1 unit per every 8 μL of PEARL extract, New England BioLabs) or with RNase A (0.1 mg per every 8 μL of PEARL extract ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μL RNA was mixed with 2 μL of 100 μM PvG748-SBS12-RT random hexamer primer (IDT) and 1 μL of 10 mM dNTP mix (NEB). The sample was incubated for 3 min at 65 °C and transferred to ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... 13.5 μL digestion reaction product was combined with 1.5 μL second-strand synthesis (SSS) buffer and 1 μL of SSS enzyme mix from the NEBNext mRNA Second Strand Synthesis Module (NEB) and incubated at 16 °C for 2.5 h ...
-
bioRxiv - Molecular Biology 2020Quote: In vitro cleavage assay with the purified AsCas12a and SpCas9 nucleases was carried out in a volume of 30 µL in 1× NEB2.1 buffer (New England Biolabs Inc.). The standard reaction containing 10 nM of PCR-obtained DNA template ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a final volume of 50 μl for 1 h at 37°C and 1X T4 of RNA Ligase Reaction Buffer (NEB, 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of Universal nuclease (Pierce; 125U/L of culture) and 10 μl of DNaseI (NEB; 20U/L of culture) were added and the mixture allowed to incubate for 10 min at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... The HIS-SUMO-BAHEPR-1 fusion and HIS-SUMO tag constructs were expressed in Escherichia coli BL21 DE3 cells (New England BioLabs). Both HIS-SUMO-BAHEPR-1 and HIS-SUMO cultures were initially grown in 4 liters of LB media at 37 °C at 200 RPM until cultures reached an optical density of ∼ 1.0 at 600 nm and then cultures were pelleted ...
-
bioRxiv - Cell Biology 2022Quote: SDS-PAGE and Western blot analysis were performed as previously described (Alpy et al, 2005) using the following antibodies: rabbit anti-GFP (1:2000; TP401, Torrey Pine Biolabs), rabbit anti-MOSPD2 (1:250 ...
-
bioRxiv - Genomics 2019Quote: ... DNA fragments were circularized in a dilute mixture of 1ng/μL DNA in T4 DNA ligase buffer with 1 cohesive end unit/μL T4 DNA ligase (New England Biolabs) for 16 hours at 16ºC ...
-
bioRxiv - Genomics 2019Quote: ... Beads were washed twice with SPRI wash buffer and resuspended in 200 ul of intra-aggragete mix (171 ul water, 1 ul 100 mM ATP, 20 ul 10x NEB T4 DNA Ligase Buffer ...